Module 7 Molecular Genetics

Lesson 3.7.3

3.7.3 page2

Explore

Here is a video to watch:

Read

DNA has a very important purpose. It contains all of the genetic code needed to build an organism. The order of the nucleotides in DNA provides the code that determines how the amino acids must be strung together to build a protein. A gene is a sequence of nucleotides on the DNA strand that codes for the production of one or more proteins. To express a gene, the genetic information is passed down from DNA, to RNA, to protein. Passing the genetic information from DNA to RNA is called transcription. Translation is the term to describe the process of passing the message from RNA to protein. Both processes will now be explained in detail.

genetic code: the order of base pairs in a DNA molecule

amino acid: an organic compound consisting of a carboxylic acid group, an amino group and other side groups linked together by peptide bonds to form proteins; the building blocks of protein

protein: organic macromolecule assembled from subunits of amino acids

gene: a specific sequence of DNA that encodes a protein, tRNA, rRNA or regulates the transcription of such a sequence

transcription: a strand of messenger RNA (mRNA) is produced that is complementary to a segment of DNA

translation: second stage of gene expression, in which the mRNA nucleotide sequence directs the synthesis of a polypeptide with the aid of tRNA

Transcription

messenger RNA (mRNA): strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription

sense strand: the one strand of nucleotides from the double-stranded DNA molecule that is transcribed

anti-sense strand: strand of nucleotides from the double-stranded DNA molecule that is complementary to the sense strand and is not transcribed

RNA polymerase: main enzyme that catalyzes the formation of RNA from the DNA template

promoter region: during transcription, a sequence of nucleotides on the DNA molecule that tells the RNA polymerase complex where to bind

Transcription takes place in the nucleus, and is dependent on one type of RNA: mRNA (messenger RNA). The DNA molecule remains in the nucleus and the information or code for a gene is copied onto mRNA. Messenger RNA is a single strand of RNA coded from one strand of the DNA molecule called the sense strand. The other strand, which is not coded, is called the anti-sense strand. Take a look at figure 18.13 on page 638 of the textbook to see the difference between the sense and anti-sense strands. RNA polymerase is the enzyme that binds to the DNA strand at the promoter region. RNA polymerase then opens the DNA double helix and builds a strand of mRNA (in the 5’ to 3’ direction) that is complementary to the DNA sense strand. When the stop signal is reached, the RNA polymerase detaches from the DNA strand and the DNA double helix reforms. You can read more about transcription in your textbook on pages 636 to 638, or if you prefer, you can watch the video below to review transcription. You may wish to make summary notes, labeled diagrams, or flow charts to add to your study notes for later review.

Watch and Listen

The following video is a good review of the transcription process. Watch the sections titled “DNA and RNA” and “Bio Discovery: Transcription”. You may need to contact your instructor in order to get a password and username to access the LearnAlberta website.

Try This #1

A DNA strand contains the following nucleotide sequence:

TACTGCCTCCCCATAAGAATT

What is the nucleotide sequence of the mRNA strand that is transcribed from this DNA template?

Check your work.

Read

Translation

Translation is the process of turning the mRNA sequence into an amino acid chain (protein). The mRNA codons determine which amino acid will be added to the chain. A codon is a set of three bases. For example, the codon ACU codes for the amino acid threonine. Look at table 18.3 on page 637 of your textbook to see a table of mRNA codons and the corresponding amino acid for each. Read p. 636 and 637 “The Genetic Code” in your textbook to understand the three important characteristics of the genetic code, and to learn how you use this table. For exams, including the Diploma exam, you will always be provided with this table.

Look back to the Try This question above. You determined the mRNA base sequence to be AUGACGGAGGGGUAUUCUUAA.

To translate this base sequence into an amino acid sequence, first separate the sequence into 3 nucleotide codons (each nucleotide can only be used in one codon) as shown:

codon: set of three bases that code for an amino acid or termination signal

AUG ACG GAG GGG UAU UCU UAA

The first codon, AUG, codes for methionine (or start). Use the chart on page 637 for help in identifying the amino acids.

The second codon, ACG, codes for the amino acid threonine.

The third codon, GAG, codes for the amino acid glutamate.

Try This #2

Use the table 18.3 on p. 637 to find the amino acid that corresponds to each of the following codons.
1. GGG
2. UCU
3. AGU
What is one RNA codon that corresponds to a “stop” signal?
How many different codons correspond to the amino acid leucine?

Check your work.

Read

transfer RNA (tRNA): type of RNA that works with messenger RNA (mRNA) to direct the synthesis of a polypeptide in a process known as translation

anticodon: specialized base triplet located on one lobe of a transfer RNA molecule that recognizes its complementary codon on a messenger RNA (mRNA) molecule

Translation of the messenger RNA occurs in the cytoplasm of the cell, with the help of transfer RNA (tRNA). One side of the tRNA contains the anticodon that is complementary to the mRNA codon, the other side is a binding site for the amino acid that corresponds to the codon. Figure 18.14 on page 639 shows a tRNA molecule that carries the amino acid arginine.

Ribosomes, which contain ribosomal RNA (rRNA), help by bringing together the tRNA strand, the mRNA strand and other enzymes needed to build the protein. The initiator or start codon on the mRNA is AUG. Read through Figure 18.15 to see the steps that translation follows.