Module 7
1. Module 7
1.10. Page 2
Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis
Explore
Read
DNA has a very important purpose. It contains all of the genetic code needed to build an organism. The order of the DNA nucleotides in DNA provides the code that determines how the amino acids must bond together to form a protein. A gene is a sequence of nucleotides on the DNA strand that codes for the production of one or more proteins. To express a genetic code, the genetic information must be passed from DNA, to RNA, to protein. Passing the genetic information from DNA to RNA is called transcription. Translation is the term to describe the process of passing the message from RNA to protein. This lesson will explain both processes in detail. For an introduction to protein synthesis, read page 636 to the end of “The Genetic Code” on page 637 of the textbook.
amino acid: an organic compound consisting of a carboxylic acid group, an amino group, and other side groups linked together by peptide bonds to form proteins; the building blocks of proteins
transcription: a strand of messenger RNA (mRNA) is produced that is complementary to a segment of DNA
translation: second stage of gene expression, in which the mRNA nucleotide sequence directs the synthesis of a polypeptide with the aid of tRNA
Transcription
mRNA (messenger RNA): strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription
sense strand: the one strand of nucleotides from the double-stranded DNA molecule that is transcribed
anti-sense strand: strand of nucleotides from the double-stranded DNA molecule that is complementary to the sense strand and is not transcribed
RNA polymerase: main enzyme that catalyzes the formation of RNA from the DNA template
promoter region: during transcription, a sequence of nucleotides on the DNA molecule that tells the RNA polymerase complex where to bind
Transcription takes place in the nucleus, and is dependent on one type of RNA: mRNA (messenger RNA). The DNA molecule remains in the nucleus. The information or code found on a gene to synthesize a particular protein in the ribosome of the cytoplasm must be copied onto mRNA. mRNA is a single strand of RNA coded from one strand of the DNA molecule called the sense strand. The other strand of DNA, which is not coded, is called the anti-sense strand. Note the difference between the sense and anti-sense strands in “Figure 18.13” on page 638 of the textbook.
RNA polymerase is the enzyme that binds to the DNA strand at the promoter region. RNA polymerase then opens the DNA double helix and builds a strand of mRNA (in the 5’ to 3’ direction) that is complementary to the DNA sense strand. When the stop signal (a triplet code, or sequence of 3 nitrogen bases, that stops the synthesis process) is reached, the RNA polymerase detaches from the DNA strand and the DNA double helix reforms.
The newly formed mRNA that now has the code for the synthesis of a particular protein can leave the nucleus and move to the ribosome. It is aptly termed “messenger” RNA. You may choose to read the “Transcription” section in your textbook on pages 637 to 638, or you may choose to watch the video outlining transcription in the following Watch and Listen section. You may also choose to do both to ensure you fully understand this process. Make summary notes, labelled diagrams, or flow charts on this important concept for your course folder.
Watch and Listen
To view the process of transcription watch the video “Transcription: DNA to Messenger RNA: Getting the Message Out.” Watch sections “DNA and RNA” and “Bio Discovery: Transcription.” You may need to contact your teacher for a password and username to access the LearnAlberta website.
Self-Check
SC 1. A DNA strand contains the following nucleotide sequence:
TACTGCCTCCCCATAAGAATT
What is the nucleotide sequence of the mRNA strand that is transcribed from this DNA template?
Self-Check Answers
SC 1. AUGACGGAGGGGUAUUCUUAA
Remember that when adding complementary nucleotides to build the mRNA strand, thymine (T) is not found in RNA; so, uracil (U) will be added to the mRNA strand to “match up” with the adenine in the DNA strand.
Read
Translation
Translation is the process of the mRNA nucleotide sequence directing the formation of an amino acid chain (protein). The mRNA codons determine which amino acid will be added to the chain. A codon is a set of three bases. For example, the mRNA codon ACU codes for the amino acid threonine. “Table 18.3” on page 637 of your textbook allows you to determine the corresponding amino acid for mRNA codons.
This is an essential skill in Biology 30. Review “The Genetic Code” on pages 636 and 637 in your textbook to ensure that you know how to use this table. Remember to find the first base in a codon in the left-hand column, and then narrow your choices by finding the second base from the section at the top of the table. Find the amino acid by using the right-hand column to find the last nitrogen base in the codon. It’s rather like reading the distance information between two destinations on a road map: read down and across for the three sections of nitrogen bases to find the corresponding amino acid. For exams, including the Diploma Exam, you will always be provided with this table.
Practice Example
Recall the DNA strand TACTGCCTCCCCATAAGAATT from SC 1. You determined the mRNA base sequence to be AUGACGGAGGGGUAUUCUUAA.
To translate this base sequence into an amino acid sequence, separate the sequence into codons of three nucleotides (each nucleotide can only be used in one codon) as shown:
AUG ACG GAG GGG UAU UCU UAA
The first codon, AUG, codes for a start signal and for methionine. Practise using the chart on page 637 until you understand how to identify the amino acids. When AUG is at the beginning of the sequence it codes for a start signal , or if the chain has been initiated, it codes for methionine.
The second codon, ACG, codes for the amino acid threonine.
The third codon, GAG, codes for the amino acid glutamate.
Self-Check
SC 2. Use “Table 18.3” on page 637 of your textbook to find the amino acid that corresponds to each of the following codons.
- GGG
- UCU
- AGU
SC 3. What is one RNA codon that corresponds to a “stop” signal?
SC 4. How many different codons correspond to the amino acid leucine?
Self-Check Answers
SC 2.
- glycine
- serine
- serine
SC 3. UAA or UAG or UGA
SC 4. 6
Read
tRNA (transfer RNA): type of RNA that works with messenger RNA (mRNA) to direct the synthesis of a polypeptide in a process known as translation
anticodon: specialized base triplet located on one lobe of a transfer RNA molecule that recognizes its complementary codon on a messenger RNA (mRNA) molecule
Translation of the messenger RNA occurs in the cytoplasm of the cell with the help of tRNA (transfer RNA). One side of the tRNA contains the anticodon that is complementary to the mRNA codon, the other side is a binding site for the amino acid that corresponds to the codon. “Figure 18.14” on page 639 shows a tRNA molecule that carries the amino acid arginine.
Ribosomes, which contain ribosomal RNA (rRNA), help by bringing together the tRNA strand, the mRNA strand, and other enzymes needed to build the protein. The initiator or start codon on the mRNA is AUG. Read “Translation” from pages 638 to 640 and note “Figure 18.15” (extends onto the top of page 641) to see the steps of translation.
You may choose to complete the Watch and Listen section on the next page before you summarize the information on protein synthesis for your course folder. A well-labelled flow chart or diagram is useful.