Module 7

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Introduction

Mendel never had the opportunity to look through a microscope. He never observed cells or their structures. The use of a microscope and the discovery of cell nuclei and DNA occurred much later in history. In this module, you will learn about the historical events that led to the discovery of DNA and its structure. You will learn how this amazingly simple and yet complicated structure can code for genetic traits, make copies of itself, and direct the synthesis of protein (the major component of so many body parts, like the hormones you learned about in Unit A, and enzymes).

There are enzymes that can clip DNA apart, and enzymes that put it back together in a new way. You will explore this source of variation and its application in various technologies that can have societal, economic, and environmental implications. Furthermore, DNA has the tendency to stay the same, and yet it changes. These changes are random and can result in abnormalities. They can also provide a source of variation that is the basis for evolution.

You can trace relationships between organisms of different species by comparing their genetic material. The field of genetic technology is rapidly developing many ways to alter genetic traits and treat genetic diseases by applying our understanding of DNA. These technologies often go hand-in-hand with current societal, medical, and ethical issues. You will have the opportunity to examine some of these issues.

In this module you will explore the following inquiry question:

• Can the transmission of traits at the molecular level be explained by understanding the structure of DNA, its role in protein synthesis, and how it could mutate?

As you complete this last module in Unit C, you are reminded about The Key and Student Notes and Problems Workbook: Biology 30 that were recommended to you for additional support towards your success. Information about these resources was provided in the Biology 30 Course Introduction. The key to success in genetics is practice. These multiple-choice, numerical-response, and written-response questions from past Diploma Exams are useful practice tools.

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Big Picture

It’s a bird, it’s a plane, no . . . it’s . . . it’s Superman! During your youth (and probably even today) you enjoyed playing, imitating, and watching your favourite superhero take down the “bad guys.”  What made these heroes “super”? These superheroes had special powers above and beyond a regular human being. Whether it be super strength, the ability to fly, or enhanced senses, these powers were usually caused by some sort of freak accident or tragic event.

In this module, you will learn that DNA codes for all of the body’s structures and functions. Mutation can occur in your DNA. As you explore the causes and effects of these mutations, you can decide whether superheroes could ever really exist. Could Peter Parker really have been bitten by a radioactive spider and given his spider-like abilities? Could the Incredible Hulk really be created by exposure to gamma radiation? Could other, less obvious mutations occur?

Explaining the transmission of traits at the molecular level by understanding the structure of DNA, its role in protein synthesis, and how it could mutate will help you determine the answers to some of these questions.

In Module 7 you will explore the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?
• What is the significance of finding the DNA code?
• How does DNA code our genetic message?
• How do new cells get a copy of this message?
• How is the genetic code in DNA copied and used to assemble amino acids into proteins?
• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and negative result?
• What are the causes of changes in DNA?
• What roles do restriction enzymes and ligases play in changing the genome?
• What are some technologies involved in genetic engineering?
• What are the implications of genetic manipulation?
• How can base sequences be used to trace relationships between organisms within a family and between different species?

You have been introduced to the focusing questions for this module. Each lesson will restate these focusing questions to guide your study. To help you organize the concepts you learn in Module 7 and to provide you with a study aid for review before you complete the Module Assessment, you may choose to download the Module 7 Concept Organizer.

Fill in this concept organizer with the ideas you master as you work through each lesson, or prepare the organizer when you have completed Module 7. You can use keywords, point form, or any amount of detail that meets your needs. You may choose to work from the file on your computer, print the document and work from the paper copy, or copy the outline onto a large sheet of poster paper. After you have prepared your concept organizer, you may wish to check your work with the concept organizer provided in the Module Summary. The concept organizer provided outlines some of the key topics that you should include in each lesson of your concept organizer. This is a great tool to review and use for study purposes, but using this organizer is completely your choice.

In the Module Assessment for Module 7, you will act as a hematologist, presenting your proposed cure for the genetic condition of sickle cell anemia to investors representing drug companies. Your presentation must include the following components:

• a description of the biological and societal effects of sickle cell anemia
• an explanation of how the mutation occurred
• a technical explanation of how your proposed cure would correct the DNA mutation through genetic engineering
• an explanation of why your proposal, if done at the zygote stage, would be a permanent cure

For more details about the Module Assessment, refer to the Module Summary.

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

In this Module

Inquiry Question: Can the transmission of traits at the molecular level be explained by understanding the structure of DNA, its role in protein synthesis, and how it could mutate?

There are six lessons in Module 7.

Most of the lessons are designed to take you 80 minutes to complete; however, some lessons may take longer because of the significance of the concept being covered in the lesson. The suggested lesson times do not include the time needed to complete such activities as “Try This,” “Watch and Listen,” assignments, practice questions, review, or research.

This module corresponds to Chapter 18, pages 624 to 665, in your textbook. You may choose to briefly read through these pages for an overview before you begin this module.

Lesson 1: DNA Structure

All organisms begin life as a single cell. All of the information for forming body parts and for controlling body processes must be stored in that single original cell. Many scientists, and various events and discoveries, led to the identification of the molecule that holds all of this cellular information, DNA.

In this lesson you will consider the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?
• What is the significance of finding the DNA code?

Lesson 2: DNA Replication

If you had the complete Book of Life, how would you copy it for your children? Would you write it out? Would you photocopy it? How would you know that it didn’t contain any mistakes? The DNA from the single original cell must be replicated as the cell divides. Mistakes in this replication process can be life-threatening.

In this lesson you will consider the following focusing questions:

• How does DNA code our genetic message?
• How do new cells get a copy of this message?

Lesson 3: Protein Synthesis

Do you have milk “issues”? Many people are not able to eat or drink dairy products because they contain lactose. One reason for this intolerance is their body’s inability to make the enzyme lactase. Our bodies use the DNA in our cells to build all of the proteins needed to survive, including enzymes like lactase. This process is called protein synthesis.

In this lesson you will consider the following focusing question:

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

Lesson 4: Changes in the Genetic Code

Do genetic superheroes really exist? It depends on your definition of “superhero.” On the African subcontinent, communities are ravaged by malaria. The genetic makeup of those communities is changing. In related communities without malaria, founded by the African communities, the genetic makeup is not changing. In Africa, the gene for sickle cell anemia is increasing in frequency in the population’s gene pool. People with one copy of the sickle cell gene can survive malaria. These individuals are stronger, live longer, and pass the gene to their children. In this lesson, we will explore how random changes (mutation) can provide a source of genetic variation in a population.

In this lesson you will consider the following focusing questions:

• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and a negative result?
• What are the causes of changes in DNA?

Lesson 5: Genetic Engineering

Who owns your DNA? Will you always own your DNA? The Human Genome Project has now identified the entire sequence of human DNA. How will this important knowledge be used? Research companies have valuable patents on specific sequences of plant and animal DNA sequences developed in laboratories. Will they also patent human DNA sequences? This valuable knowledge of DNA sequences has been used to transform DNA through genetic engineering.

In this lesson you will consider the following focusing questions:

• What roles do restriction enzymes and ligases play in changing the genome?
• What are some technologies involved in genetic engineering?
• What are the implications of genetic manipulation?

Lesson 6: You Are Your Genetic Code

Human DNA is similar to the DNA of a pig and to a stalk of corn. How did we get to be similar? What does this mean? In this lesson we will see how DNA can be used to trace evolutionary and genetic relationships among organisms and species.

In this lesson you will consider the following focusing question:

• How can base sequences be used to trace relationships between organisms within a family and between different species?

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 1—DNA Structure

Get Focused

All organisms begin life as a single cell. All the information for forming body parts and controlling body processes must be stored in that single, original cell. As stated in the Cell Theory from Science 10, cells are the basis of the following:

• structure
• function
• heredity for all living things

The work of many scientists, various events, and experiments led up to the identification of the molecule that holds all of this cellular information, DNA (deoxyribonucleic acid). During the process of discovery, some scientists concentrated on identifying the molecule of heredity while, simultaneously, others were studying the structure of DNA. The combination of identifying DNA as the molecule of heredity, and the discovery of the DNA structure itself allowed scientists to begin searching for the mechanisms and processes involved in passing genetic information from one generation to the next. Once the molecule responsible for passing on all information to the next generation was identified, scientists imagined the possible applications of this knowledge.

The discovery of DNA also caused the imaginations of cartoonists to take new directions. If this DNA were changed, what would happen to a person? Think of comic superhero Spiderman. The age of mutant superheroes began.

This lesson will address the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?
• What is the significance of finding the DNA code?

Module 7: Lesson 1 Assignment

 Your teacher-marked Module 7: Lesson 1 Assignment requires you to submit responsed to the following:

• “Thought Lab 18.1: DNA Deductions” from page 629 of the textbook for assessment
  

Download a copy of the Module 7: Lesson 1 Assignment to your computer now. You will receive further instructions on how to complete this assignment later in the lesson.

The other questions in this lesson are not marked by the teacher; however, you should still answer these questions. The “Self-Check” and “Try This” questions are placed in this lesson to help you review important information and build key concepts that may be applied in future lessons.

After a discussion with your teacher, you must decide what to do with the questions that are not part of your assignment. For example, you may decide to submit to your teacher the responses to “Try This” questions that are not marked. You should record the answers to all of the questions in this lesson and place those answers in your course folder.

Remember, you also have the option of trying additional questions from the textbook for further practice. Consult with your teacher for the answers to these questions. The Key will also provide you with many Diploma Exam-style multiple-choice, numerical-response, and written-response questions that will be an excellent review of the module. Practising your responses to these types of questions is good preparation for the Diploma Exam.

Required Materials and Equipment

paper, scissors, and pencil crayons (if paper model is chosen)

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

Identifying the DNA as the molecule responsible for heredity took many years and the effort of many scientists. At the same time, other scientists were trying to determine the structure of DNA.

DNA, then known as “nucleic acid,” was first isolated from the nuclei of white blood cells by Friedrich Miescher in 1869. At this time, there was no connection made between this molecule and heredity. It took experiments by Phoebus Levene, Frederick Griffith, Alfred Hershey, and Martha Chase to finally prove that DNA was the molecule responsible for heredity. Before the connection to DNA was made, many scientists felt that protein, with all its possible forms, was the molecule responsible for the inheritance of so many traits and all the variations seen in living things.

While these scientists were looking for the agent of heredity, other scientists were studying the DNA molecule structure. Phoebus Levene first discovered that DNA was made up of chains of four different nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T). He also noted that RNA (ribonucleic acid, a molecule that you will study in Lesson 2) was also made up of four nucleotides, but that it had the base uracil (U) instead of thymine (T). Levene, unfortunately, incorrectly proposed that all nucleotides were found in the same concentration and in the same repeating order. This led scientists to believe that DNA couldn’t be the molecule of heredity. It seemed too simple to code for all the variation in living things.

Later, when Erwin Chargraff found that adenine (A) and thymine (T) are found in equal amounts in any sample of DNA, and cytosine and guanine were also found in equal amounts (but different to A and T), Levene’s hypothesis was disregarded and Chargaff’s rule of constant relationships between A and T, and C and G were accepted. Later still, the combination of Rosalind Franklin’s use of X-ray photography and the work of James Watson and Francis Crick produced the double helix structure model of the DNA molecule.

Learn more about the contributions of the above-mentioned scientists by reading pages 624 to “The Double Helix Structure of DNA,” on page 628. Summarize your readings by creating a timeline that includes scientists, experiments, and major discoveries that led to the identification of the hereditary agent and the structure of the DNA molecule. Place this timeline in your course folder for further reference when studying.

Watch and Listen

Watch the animation of the “Hershey and Chase experiment” that proved the identity of the molecule controlling heredity. After watching this animation, you should be able to explain how this experiment proves that DNA, not protein, is the hereditary molecule. To view this animation, you may need a password from your teacher for the LearnAlberta website.

Watch the video “Introduction to Molecular Genetics: The Search for the Genetic Code.” The video also reviews the scientists and experiments that led to the discovery of DNA and its purpose and structure. This video supports the textbook reading of pages 624 to 628 that you just completed. Use the video to supplement your reading. You may need a password from your teacher to access the LearnAlberta website.

Self-Check

SC 1. Complete this interactive activity “Scientists and Their Discoveries.” Make sure you complete all four activities. You will check your work as you complete the activity.

The Structure of DNA

It is essential that you master an understanding of the structure of DNA; therefore, complete both the following Watch and Listen and Read sections. Depending on your learning style, you may choose to do the video first, followed by the reading, or to do the reading followed by the video.

Watch and Listen

Structurally, DNA is a three-dimensional molecule. Imagine a spiral staircase and you will understand the structure of DNA. For the details of DNA, watch the video “DNA Structure and Replication: Duplicating the Code.” Note the double helix shape and the arrangement of the deoxyribose sugars, phosphates, and nitrogen bases in the molecule. The relationship between DNA, chromosomes, and cells is also reviewed in the video. You will watch students perform a lab in which they extract and isolate DNA from calf thymus cells. When you get to “Replication of DNA,” stop the video. This topic will be covered in Lesson 2. You may need a password from your teacher in order to access the LearnAlberta website.

Read

Many concepts in genetics are fundamental to the understanding of the structure of DNA. To be ready to apply your understanding of DNA structure to new situations in genetics, read “The Double Helix Structure of DNA” in your textbook on pages 628 to 629.  Note Figure 18.6 on page 628 showing the arrangement of the deoxyribose sugars, phosphates, and nitrogen bases in the molecule. You should also note the definition of complementary base pairs, and the idea that the two strands of nucleotides in the double helix run antiparallel to each other. Adding a diagram that illustrates these features to your course folder would be an excellent idea.

Try This

TR 1. Complete either Choice 1 or Choice 2.

Choice 1: Building DNA Gizmo

Use the “Building DNA Gizmo” to virtually build DNA molecules. Follow the steps outlined in the Exploration Guide to complete this activity. You may stop at the “DNA Replication” section, since this will be covered in Lesson 2. Be sure you are able to answer the questions in the guide as you move through each step. Contact your teacher if you have difficulties. If required, contact your teacher for the LearnAlberta password in order to access this gizmo.

Choice 2: Building DNA

For a more “hands-on” activity, you can build a DNA molecule from a paper template. This will allow for a more three-dimensional visual representation of the double helix. Based on the information from the video or your reading, or by doing a search on the Internet for ”DNA + model + paper template” to find your own model, build your own three-dimensional DNA. Keep your paper model, as you may use it in other lessons.

Self-Check

SC 2. It is essential to understand the structure of DNA. To ensure your mastery, complete the DNA Self-Check. 

Module 7: Lesson 1 Assignment

Retrieve the copy of the Module 7: Lesson 1 Assignment that you saved to your computer earlier in this lesson. Complete the assignment. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Reflect on the Big Picture

It’s a bird, it’s a plane, no . . . it’s . . . it’s Superman! What made these heroes “super”? These superheroes had special powers above and beyond a regular human being. Based on your knowledge of DNA and mutations, is it possible for superheroes to really exist? Could Peter Parker really have been bitten by a radioactive spider and given his spider-like abilities? Could the Incredible Hulk really be created by exposing someone to gamma radiation? Could other, less obvious mutations occur?

The discovery of the structure of DNA in 1953 allowed scientists to begin understanding how hereditary information is passed from generation to generation. Knowing this structure allows scientists to explore the processes that can occur to change our hereditary information. Processes like mutations were examined at the molecular level.

The concept that mutations could cause strange superhuman effects was rarely found in the cartoon industry before the 1950s. Once DNA was discovered, more and more mutant superheroes were created. Research a superhero that developed her or his powers through some sort of mutation. Record the details of this superhero’s mutation—the how, when, why, what, and where of the mutation. Place this information in your course folder to be referred to in the next lesson.

Module 7: Lesson 1 Assignment

Submit your completed Module 7: Lesson 1 Assignment to your teacher for assessment.

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?
• What is the significance of finding the DNA code?

The discovery that DNA is the molecule responsible for heredity and the discovery of DNA’s structural characteristics go hand-in-hand. Once scientists could see, and were able to closely examine, the structure of DNA, it became obvious that this molecule had to be responsible for passing genetic information on to the next generation. Throughout this lesson you have learned about some of the many scientists who contributed to solving these scientific questions. Every experiment and discovery built on the last, pushing forward toward the eventual result—the structure and function of DNA.

The double helix that Watson and Crick modelled would not have been possible without the x-ray image from Rosalind Franklin. The complementary base pairing in Watson and Crick’s model may not even have been thought of without the information from Phoebus Levene and his identification of the four nucleotides and their respective percent compositions. In this lesson, you have learned about the history of the identification of DNA and the structure of DNA. In the next lesson you will see how DNA’s structure directly determines its function.

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

adenine (A): a nitrogenous base of the purine group; complementary base pairs with thymine

antiparallel: describes the property by which the 5’ to 3’ phosphate bridges run in opposite directions on each strand of nucleotides in a double-stranded DNA molecule

Chargaff’s rule: in any sample of DNA, there is a constant relationship in which the amount of adenine is always approximately equal to the amount of thymine, and the amount of cytosine is always approximately equal to the amount of guanine

complementary base pairs: refers to the hydrogen-bonded, nitrogenous base pairs of adenosine and thymine, and of cytosine and guanine in the DNA double helix

cytosine (C): a nitrogenous base of the pyrimidine group; complementary base pairs with guanine

deoxyribose sugar: a ring-shaped sugar; has one less oxygen than ribose sugar

DNA (deoxyribonucleic acid): a double-stranded nucleic acid molecule that governs the processes of heredity in the cells of all organisms

It is composed of nucleotides containing a phosphate group, a nitrogenous base, and deoxyribose.

double helix: spiral ladder shape of the DNA molecule, made up of two long strands of nucleotides bound together and twisted

guanine (G): a nitrogenous base of the purine group; complementary base pairs with cytosine

mutation: a change in the sequence of bases on the DNA molecule

nitrogen base: an organic molecule containing nitrogen; two types present in DNA: double-ringed purines (adenine and guanine) and single-ringed pyrimidines (cytosine and thymine)

nucleotide: the repeating unit (monomer) of DNA; two strings of nucleotides joined in the middle by hydrogen bonds form a DNA molecule; each nucleotide is made up of a deoxyribose sugar, a nitrogenous base, and a phosphate group

phosphate: an inorganic phosphate group (POPO43–)

RNA: ribonucleic acid; a short, single strand composed of nucleotides with a nitrogen base, ribose sugar, and phosphate group; nitrogen bases include adenine, guanine, cytosine, and uracil; has a role in protein synthesis

thymine (T): nitrogenous base of the pyrimidine group; complementary base pairs with adenine

uracil (U): a nitrogenous base found only in RNA, not DNA; replaces thymine when paired to adenine

Watson and Crick: credited with co-discovery of the structure of DNA; received the Nobel Prize for their work

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 2—DNA Replication

Get Focused

The Book of Life has been written over centuries to record the history of humans, particularly philosophies of religion and insights of life. If you had the complete Book of Life, how would you copy it for your children? Would you write it out? Would you photocopy it? How would you know that your copy didn’t contain any mistakes?

The DNA from a single, original cell must be replicated before the cell divides. Mistakes in this replication process can be life-threatening. The structure of DNA that you learned about in Lesson 1 copies hereditary information in a unique way termed DNA replication. In Lesson 4, you will discover that this process isn’t perfect. Mistakes do happen. Could superheroes be created through these mistakes? Keep this question in mind as you move through the lesson.

This lesson will address the following focusing questions:

• How does DNA code our genetic message?
• How do new cells get a copy of this message?

Module 7: Lesson 2 Assignment

Your teacher-marked Module 7: Lesson 2 Assignment requires you to submit a response to the following:

• a series of questions on DNA and RNA involving the following:
  •  an illustration of DNA replication
  •  a comparison of DNA and RNA
  •  an illustration of semi-conservative replication

Download a copy of the Module 7: Lesson 2 Assignment to your computer now. You will receive further instructions on how to complete this assignment later in the lesson.

You must decide what to do with the questions that are not marked by the teacher.

Remember that these questions provide you with the practice and feedback that you need to successfully complete this course. You should respond to all of the questions and place those answers in your course folder.

You also have the option of trying additional questions from the textbook for further practice. Consult with your teacher for the answers to these questions. The Key will also provide you with many Diploma Exam-style multiple-choice, numerical-response, and written-response questions that will be an excellent review of the module. Practising your responses to these types of questions is good preparation for the Diploma Exam.

Required Materials and Equipment

paper, scissors, and pencil crayons (if paper model is chosen)

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

DNA and RNA are both nucleic acids. However, their structures and functions are very different. These differences become significant in DNA replication and in protein synthesis. You will learn about DNA replication in this lesson; however, protein synthesis will be examined in Lesson 3. To better understand the differences between the structures of DNA and RNA, read page 629 in the textbook, “RNA.” An excellent way to summarize the differences between DNA and RNA is in a comparative chart. As you work through this module, you should create a chart to add information about these differences, including a comparison of the number of strands, type of sugar present, type of nitrogen bases in each molecule, location of the molecules, and role. This chart will be useful as a summary and study aid.

In Module 5 you learned that when a cell divides to form two new cells, it must replicate, or make a copy of its entire DNA—the entire genome! In the last lesson you began learning about this DNA replication method by studying the structure of the DNA molecule. The double-stranded structure of DNA leads to a special copying mechanism noted by Watson and Crick. When a cell creates copies of its DNA by way of DNA replication, the new molecules of DNA each contain one of the original strands of the DNA.

This makes replication a semi-conservative process: the new molecules of DNA have one “old” or original strand, and one “new” or newly formed strand. Examine “Figure 18.8” on page 631 of the textbook to see how one strand of the original “blue” DNA is found in each of the new copies of DNA, or examine the diagram provided below. To become familiar with the features of DNA replication, read from “Genes and the Genome” on page 629 to “Section 18.1 Summary” on page 633 in the textbook.

DNA replication is an important concept to master. You may wish to complete the Read and Watch and Listen sections to ensure your understanding before you attempt to summarize the information for your course folder. According to your learning style, decide on the best way to summarize this information.

Initiation of DNA Replication

DNA replication begins at the replication origin, a specific nucleotide sequence that the enzyme helicase can bind to on the DNA. The helicase enzyme cuts (cleaves) the DNA and unravels part of the double helix. The oval-shaped area created by the unwound double helix is called the replication bubble, and at each end of this oval is a Y-shaped area called a replication fork. Study “Figure 18.9” on page 631, or the diagram in the lesson, to visualize these areas. The single strands in the replication bubble act as a template for creating the new copy strands of DNA (the pink strands in “Figure 18.9”).

Elongation and Termination

Elongation of the new DNA strand occurs when the enzyme DNA polymerase adds DNA nucleotides to the template strands inside the replication bubble. An RNA primer must first be constructed by the enzyme primase before DNA polymerase can do its job. This is because DNA polymerase can only add DNA nucleotides to an existing free 3’ hydroxyl end of a nucleotide chain. Once the primer is in place, DNA polymerase is able to attach a DNA nucleotide to the free 3’ hydroxyl end of the primer. You can see the –OH (hydroxyl group) on carbon 3’ in “Figure 18.3” on page 626 of your textbook. DNA polymerase then removes the RNA primer.

Recall the structure of DNA. The two complimentary strands are joined together in the opposite directions, antiparallel. Study “Figure 18.10” on page 632, or the diagram in this lesson, and notice how one strand is in the 3’ to 5’ direction while the complimentary strand is in the 5’ to 3’ direction. Since DNA polymerase can only add DNA nucleotides in the 5’ to 3’ direction, only one strand can be continuously added to. This strand is called the leading strand. The other strand of DNA is called the lagging strand and must be replicated in short segments called Okazaki fragments. These fragments are spliced together by an enzyme called DNA ligase.

Multiple primers are needed on the lagging strand. Eventually, DNA polymerase will remove the RNA primers and fill in the space to attach the neighbouring DNA strands. DNA polymerase is also responsible for proofreading as each DNA nucleotide is added to the new strand. The process described above is very well illustrated in the animations below. DNA replication stops when the new, completed DNA strands separate from one another. This is called termination.  

Watch and Listen

Watch the animation “DNA Replication,” which is an excellent outline of the steps in DNA replication. You may find it worthwhile to watch this clip a few times.

To ensure your understanding of the role of 3’ and 5’ ends of the DNA during replication, watch the animation “DNA Replication Fork.”

For an overview of DNA replication, watch “DNA Structure and Replication: Duplicating the Code.” Begin this video at the section titled “Replication of DNA, Part I,” and end at the “Mutations” section.

Try This

TR 1. Choose from one of the following activities to apply your understanding of DNA replication.

Choice 1: DNA Gizmo

Continue with the Building DNA Gizmo from the “Try This” in Lesson 1. You can now follow the Exploration Guide to the end. Once you have finished the activity, answer the multiple-choice assessment questions. Keep in mind the action of DNA polymerase and try to visualize where it would be involved in this process. Think about where primase, helicase, DNA polymerase, and DNA ligase would function.

Choice 2: Paper DNA Model

Use your paper DNA model created in the “Try This” of Lesson 1 to simulate the process of DNA replication. Keep in mind the action of DNA polymerase, and try to simulate replication along the leading strand and the lagging strand. Think about where primase, helicase, DNA polymerase, and DNA ligase would function in your simulation. If you would like a template to build the paper DNA, obtain a print copy of “DNA Model Template.” The template will guide you through how to make a paper model. Or, conduct an Internet search for “DNA + model + paper template” to find your own model.

Self-Check

SC 1. Complete “DNA replication.” You will check your answers as you complete the activity.

Reflect and Connect

In this lesson you have learned how the structure of DNA copies hereditary information in a unique way termed DNA replication. The steps are unique and sequential. To reflect your understanding of replication, complete question 1 of the Lesson 2 Assignment. You may copy and paste, scan and attach, draw and fax, or submit your work in any appropriate format depending on which option you choose to use in completing question 1.

In Lesson 1 and 2 you have been introduced to DNA and RNA. You began developing a chart to compare their similarities and differences in structure and function. Use this chart to develop your answer to question 2 in the Lesson 2 Assignment. To be semi-conservative in your thoughts implies that you still believe in the “old ways,” but that you are willing to incorporate some new ideas. You have learned that DNA replication is semi-conservative. Reflect on how to illustrate DNA semi-conservative characteristics and complete question 3 of the Lesson 2 Assignment.

Module 7: Lesson 2 Assignment

Retrieve the copy of the Module 7: Lesson 2 Assignment that you saved to your computer earlier in this lesson. Complete the rest of the assignment. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Reflect on the Big Picture

From your knowledge of DNA, its structure and function, and DNA replication, do you think it would be possible become a superhero? So far it looks like replication makes exact copies. Becoming a superhero would involve change. DNA replication is complex, and sometimes mistakes are made. Based on your knowledge of DNA structure and the many steps involved in replication, how and where do you think there is the potential for mistakes to be made? Can you speculate on how change might occur in the DNA code? Based on your knowledge of cell division and cell life cycle lines, would these mistakes accumulate as you age? You will examine some of these mechanisms of change and their consequences later in this module.

Discuss

Outline your thoughts on how and where you think mistakes might occur during DNA replication. List what you think might be the results of these mistakes. Post your work to the discussion area and share your ideas with your classmates and with your teacher.

Module 7: Lesson 2 Assignment

Before you submit your lesson assignment, you may wish to do a selection of questions from page 635 of your textbook. Your teacher can recommend which questions would be suitable to your needs.

Submit your completed Module 7: Lesson 2 Assignment to your teacher for assessment.

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing questions:

• How does DNA code our genetic message?
• How do new cells get a copy of this message?

Now you can appreciate how the structure of DNA has led directly to its ability to be copied and how the genetic code can be passed on to the new cells during cell division. The double-stranded DNA can unwind and serve as two template strands. New strands of DNA form to compliment these template strands. Two new, identical molecules of DNA result. Since an original strand of DNA is found in each new DNA molecule, the process is considered semi-conservative.

In this lesson you looked at four important enzymes and how they function in DNA replication. You have learned the difference between the leading and lagging strands and how elongation differs on each of these strands. Throughout this lesson you were asked to think about where errors could occur, causing mistakes in DNA replication. In Lesson 4 these mistakes will be discussed in more detail. In the next lesson you will see how the DNA structure codes for and is used to build proteins used in different structures by cells and bodies, such as muscles, enzymes, and hormones, and to fulfill various functions such as digestion. Do not confuse the process of DNA replication with the process of translation to be discussed in Lesson 3.

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

DNA ligase: enzyme that splices together Okazaki fragments during DNA replication of the lagging strand, or sticky ends that have been cut by a restriction endonuclease enzyme

DNA polymerase: an enzyme that slips into the space between two strands of DNA during replication to add DNA nucleotides in order to make complementary strands

DNA replication: the process of creating an exact copy of a molecule of DNA

elongation: the process of joining nucleotides to extend a new strand of DNA; relies on the action of DNA polymerase

genetic code: the order of base pairs in a DNA molecule

genome: the sum, or the entire DNA, carried in an organism’s cells

helicase: an enzyme that breaks segments of DNA during DNA replication; used in technologies to fragment DNA

lagging strand: the strand that is replicated in short segments during DNA replication

leading strand: the strand that is replicated continuously in DNA replication

Okazaki fragments: short nucleotide fragments synthesized during DNA replication of the lagging strand

primase: an enzyme in DNA replication that forms an RNA primer, which is used as a starting point for the elongation of nucleotide chains

replication bubble: oval-shaped, unwound area within a DNA molecule that is being replicated

replication fork: during DNA replication, Y-shaped points at which the DNA helix is unwound and new strands develop

replication origin: specific nucleotide sequence where replication begins

RNA primer: short strand of RNA that is complementary to a DNA template and serves as a starting point for the attachment of new DNA nucleotides

semi-conservative: term used to describe replication where each new molecule of DNA contains one strand of the original complementary DNA, and one new strand, conserving half of the original molecule

termination: the completion of the new DNA strands and the dismantling of the replication machine

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 3—Protein Synthesis

Get Focused

Have you got milk “issues”? Can’t eat or drink some dairy products? Many people are not able to consume dairy products, which contain lactose. One reason for lactose intolerance is the inability to produce the enzyme lactase needed to digest the sugar lactose found in milk. From Biology 20, you recall that enzymes are protein molecules. Another function of DNA is its role in protein synthesis. 

Although we have the genetic code, the instructions on our chromosomes must also be expressed. The genes found on our chromosomes code for proteins that are needed for our survival. Humans cannot survive without proteins. Proteins are the basis of our structure and contribute to the formation of cell membranes, muscles, bones, and hair. As you have studied, proteins also serve a functional role in antibodies, enzymes, and hormones. For example, the functional role of lactase is the digestion of lactose.

The gene for lactase and the formation of other proteins is expressed through a process called protein synthesis. When humans can’t make certain proteins, like lactase resulting in lactose intolerance, then structures or functions can be affected.

In this lesson you will learn how DNA has the genetic code for and directs the synthesis of proteins. You will discover the different types of RNA and the roles they play in the synthesis of proteins. In Lesson 4 you will discover the types of mistakes that can be made in protein synthesis and the consequences to the body’s structures and functions.

But what would happen if humans could make extra proteins, ones that are not part of the genetic code? Could humans develop the ability to make silk, as Spiderman does? Scientists have developed technologies for transferring genes from one organism to another. As you will discover later in this lesson when you read about some goats in Quebec, these genes are expressed and give the host organism some interesting qualities.

This lesson will address the following focusing question:

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

Module 7: Lesson 3 Assignment

Your teacher-marked Module 7: Lesson 3 Assignment requires you to submit a response to the following:

• questions on a RNA and protein synthesis simulation
• “Thought Lab 18.2: Transcription in Reverse” on page 639 of the textbook

Download a copy of the Module 7: Lesson 3 Assignment to your computer now. You will receive further instructions about how to complete this assignment later in the lesson.

You must decide what to do with the questions that are not marked by the teacher.

Remember that these questions provide you with the practice and feedback that you need to successfully complete this course. You should respond to all of the questions and place those answers in your course folder.

You have the option of trying additional questions from the textbook for further practice. Consult with your teacher for the answers to these questions. The Key will also provide you with many Diploma Exam-style multiple-choice, numerical-response, and written-response questions that will be an excellent review of the module. Practising your responses to these types of questions is good preparation for the Diploma Exam.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

DNA has a very important purpose. It contains all of the genetic code needed to build an organism. The order of the DNA nucleotides in DNA provides the code that determines how the amino acids must bond together to form a protein. A gene is a sequence of nucleotides on the DNA strand that codes for the production of one or more proteins. To express a genetic code, the genetic information must be passed from DNA, to RNA, to protein. Passing the genetic information from DNA to RNA is called transcription. Translation is the term to describe the process of passing the message from RNA to protein. This lesson will explain both processes in detail. For an introduction to protein synthesis, read page 636 to the end of “The Genetic Code” on page 637 of the textbook.

Transcription

Transcription takes place in the nucleus, and is dependent on one type of RNA: mRNA (messenger RNA). The DNA molecule remains in the nucleus. The information or code found on a gene to synthesize a particular protein in the ribosome of the cytoplasm must be copied onto mRNA. mRNA is a single strand of RNA coded from one strand of the DNA molecule called the sense strand. The other strand of DNA, which is not coded, is called the anti-sense strand. Note the difference between the sense and anti-sense strands in “Figure 18.13” on page 638 of the textbook.

RNA polymerase is the enzyme that binds to the DNA strand at the promoter region. RNA polymerase then opens the DNA double helix and builds a strand of mRNA (in the 5’ to 3’ direction) that is complementary to the DNA sense strand. When the stop signal (a triplet code, or sequence of 3 nitrogen bases, that stops the synthesis process) is reached, the RNA polymerase detaches from the DNA strand and the DNA double helix reforms.

The newly formed mRNA that now has the code for the synthesis of a particular protein can leave the nucleus and move to the ribosome. It is aptly termed “messenger” RNA. You may choose to read the “Transcription” section in your textbook on pages 637 to 638, or you may choose to watch the video outlining transcription in the following Watch and Listen section. You may also choose to do both to ensure you fully understand this process. Make summary notes, labelled diagrams, or flow charts on this important concept for your course folder.

Watch and Listen

To view the process of transcription watch the video “Transcription: DNA to Messenger RNA: Getting the Message Out.” Watch sections “DNA and RNA” and “Bio Discovery: Transcription.” You may need to contact your teacher for a password and username to access the LearnAlberta website.

Self-Check

SC 1. A DNA strand contains the following nucleotide sequence:

TACTGCCTCCCCATAAGAATT

Read

Translation

Translation is the process of the mRNA nucleotide sequence directing the formation of an amino acid chain (protein). The mRNA codons determine which amino acid will be added to the chain. A codon is a set of three bases. For example, the mRNA codon ACU codes for the amino acid threonine. “Table 18.3” on page 637 of your textbook allows you to determine the corresponding amino acid for mRNA codons.

This is an essential skill in Biology 30. Review “The Genetic Code” on pages 636 and 637 in your textbook to ensure that you know how to use this table. Remember to find the first base in a codon in the left-hand column, and then narrow your choices by finding the second base from the section at the top of the table. Find the amino acid by using the right-hand column to find the last nitrogen base in the codon. It’s rather like reading the distance information between two destinations on a road map: read down and across for the three sections of nitrogen bases to find the corresponding amino acid. For exams, including the Diploma Exam, you will always be provided with this table.

Practice Example

Recall the DNA strand TACTGCCTCCCCATAAGAATT from SC 1. You determined the mRNA base sequence to be AUGACGGAGGGGUAUUCUUAA. 

To translate this base sequence into an amino acid sequence, separate the sequence into codons of three nucleotides (each nucleotide can only be used in one codon) as shown:

AUG  ACG  GAG  GGG  UAU  UCU  UAA

The first codon, AUG, codes for a start signal and for methionine. Practise using the chart on page 637 until you understand how to identify the amino acids. When AUG is at the beginning of the sequence it codes for a start signal , or if the chain has been initiated, it codes for methionine.

The second codon, ACG, codes for the amino acid threonine.

The third codon, GAG, codes for the amino acid glutamate.

Self-Check

SC 2. Use “Table 18.3” on page 637 of your textbook to find the amino acid that corresponds to each of the following codons.

1. GGG
2. UCU
3. AGU

SC 3. What is one RNA codon that corresponds to a “stop” signal?

SC 4. How many different codons correspond to the amino acid leucine?

Read

Translation of the messenger RNA occurs in the cytoplasm of the cell with the help of tRNA (transfer RNA). One side of the tRNA contains the anticodon that is complementary to the mRNA codon, the other side is a binding site for the amino acid that corresponds to the codon. “Figure 18.14” on page 639 shows a tRNA molecule that carries the amino acid arginine.

Ribosomes, which contain ribosomal RNA (rRNA), help by bringing together the tRNA strand, the mRNA strand, and other enzymes needed to build the protein. The initiator or start codon on the mRNA is AUG. Read “Translation” from pages 638 to 640 and note “Figure 18.15” (extends onto the top of page 641) to see the steps of translation.

You may choose to complete the Watch and Listen section on the next page before you summarize the information on protein synthesis for your course folder. A well-labelled flow chart or diagram is useful.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Watch and Listen

This “Protein Synthesis” animation illustrates the translation process. Note how the anticodon on the tRNA molecule and the codon on the mRNA are complementary to one another. Pay attention to the slowly forming polypeptide (protein) from the bonding amino acids. You may need a password and username to access the LearnAlberta website. Contact your teacher for these. Store the information reviewed in the animation in any format you choose in your course folder for review.

Watch the video “Protein Synthesis: Translating the Code.” This video also describes translation, and it includes a review of both transcription and translation at the end of the video. You will find that watching the complete video is an excellent summary of the concepts of this lesson. You may need to contact your teacher in order to get a password and username to access the LearnAlberta website.

Module 7: Lesson 3 Assignment

RNA and Protein Synthesis Simulation

Open the “RNA and Protein Synthesis Gizmo.” Read carefully through the Exploration Guide and follow the steps described.

Retrieve the copy of the Module 7: Lesson 3 Assignment that you saved to your computer earlier in this lesson. Complete the questions in Part 1, “RNA and Protein Synthesis Simulation,” as you move through the gizmo. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Self-Check

SC 5. To practise your understanding of the steps in protein synthesis, complete the three parts of the Self-Check activity “Type of RNA.” Check your answers as you complete the activity.

Reflect and Connect

Transcription in Reverse

To practise your skills with transcription, reflect on the results of working backward from an amino acid sequence toward the original DNA sense strand. You will follow the procedure for “Thought Lab 18.2: Transcription in Reverse” on page 639 of the textbook.

Module 7: Lesson 3 Assignment

Retrieve the copy of the Module 7: Lesson 3 Assignment that you saved to your computer earlier in this lesson. Complete Part 2 of the assignment, “Transcription in Reverse.” Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Reflect on the Big Picture

Spiderman may not exist in real life, but spider goats do! Some goats in Québec have been genetically altered to produce spider silk in their milk. The silk gene of a spider was sequenced to find the DNA code. Scientists developed technologies to insert the spiders’ DNA into the goats’ DNA in a way that the gene for silk would only be expressed in the milk. There is no web-spinning by these goats, but the silk in the milk is definitely useable.

In Lesson 5 you will examine many genetic technologies. Society often questions these technologies. Why would scientists want to create and use these technologies? What are the advantages and disadvantages of these technologies? Are they applicable to humans? Could Spiderwoman actually exist?

Discuss

Using your library, the Internet, or a source of your choice, research genetically altered goats and spiders. On the Internet, use the keywords “spider goats.” Write a response to these societal concerns presenting both the pros and the cons of the issue. Share your response with your teacher and your classmates in the discussion area.

Module 7: Lesson 3 Assignment

Submit your completed Module 7: Lesson 3 Assignment to your teacher for assessment.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing question:

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

This lesson explained the steps involved in using the DNA code to synthesize proteins. Transcription of the DNA into mRNA in the nucleus must first occur. The mRNA then travels to a ribosome in the cytoplasm where translation occurs. During translation, the tRNA with complementary anticodons to the mRNA codons are matched. Each tRNA brings with it an amino acid and, with the help of enzymes’ amino acids, are bonded together. The coded sequence of amino acids is created resulting in a protein. In the next lesson you will look at changes in the genetic code and how these changes in DNA can affect the proteins being synthesized.

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

amino acid: an organic compound consisting of a carboxylic acid group, an amino group and other side groups linked together by peptide bonds to form proteins; the building blocks of proteins

anticodon: specialized base triplet located on one lobe of a transfer RNA molecule that recognizes its complementary codon on a messenger RNA (mRNA) molecule

anti-sense strand: strand of nucleotides from the double-stranded DNA molecule that is complementary to the sense strand and is not transcribed

codon: set of three bases that code for an amino acid or termination signal

gene: a specific sequence of DNA that encodes a protein, tRNA, or rRNA, or that regulates the transcription of such a sequence

lactase: an enzyme involved in the digestion of lactose 

mRNA (messenger RNA): strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription

promoter region: during transcription, a sequence of nucleotides on the DNA molecule that tells the RNA polymerase complex where to bind

protein synthesis: amino acids forming larger protein molecules under the direction of DNA

protein: organic macromolecule assembled from subunits of amino acids

RNA polymerase: main enzyme that catalyzes the formation of RNA from the DNA template

sense strand: the one strand of nucleotides from the double-stranded DNA molecule that is transcribed

transcription: a strand of messenger RNA (mRNA) is produced that is complementary to a segment of DNA

translation: second stage of gene expression, in which the mRNA nucleotide sequence directs the synthesis of a polypeptide with the aid of tRNA

tRNA (transfer RNA): type of RNA that works with messenger RNA (mRNA) to direct the synthesis of a polypeptide in a process known as translation

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 4—Changes in the Genetic Code

Get Focused

Do genetic superheroes exist? It depends on your definition of “superhero.” On the African subcontinent, communities are ravaged by malaria. The genetic makeup of subcontinental African communities is changing. The frequency of alleles involved in sickle cell anemia is changing. However, the genetic makeup in descendants of those communities who migrated to areas without malaria, such as North America, isn’t changing. The frequency of alleles involved in sickle cell anemia is stable.

In Africa, people with one copy of the sickle cell gene (heterozygous condition) can survive malaria. These individuals are stronger, live longer, and pass the gene to their children. In Africa, the gene for sickle cell anemia is increasing in frequency in the population’s gene pool. In areas without malaria, there is no adaptive advantage in the heterozygous condition. In these communities, the gene for sickle cell anemia is stable in its frequency in the population’s gene pool.

Are the people in subcontinental Africa “superheroes”? Does this mean that communities without malaria can’t be superheroes?

In this lesson we will explore how random changes (mutations) can be a source of genetic variation in a population. Sometimes these variations can be adaptive and can give the organism a competitive advantage.

This lesson will address the following focusing questions:

• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and a negative result?
• What are the causes of changes in DNA?

Module 7: Lesson 4 Assignment

Your teacher-marked Module 7: Lesson 4 Assignment requires you to submit a response to the following for assessment:

• “Thought Lab 18.3: Investigating Cancer Genes” on page 646 of your textbook
•  research a mutagen

This two-part assignment addresses the causes of mutation.

Download a copy of the Module 7: Lesson 4 Assignment to your computer now. You will receive further instructions about how to complete this assignment later in the lesson.

You must decide what to do with the questions that are not marked by the teacher.

Remember that these questions provide you with the practice and feedback that you need to successfully complete this course. You should respond to all of the questions and place those answers in your course folder.

Remember that you also have the option of trying additional questions from the textbook for further practice. Consult with your teacher for the answers to these questions. The Key will also provide you with many Diploma Exam-style multiple-choice, numerical-response, and written-response questions that will be an excellent review of the module. Practising your responses to these types of questions is good preparation for the Diploma Exam.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

The structure of DNA is not permanent. It is actually constantly changing. Enzymes like DNA polymerase repair many changes immediately, but many changes are missed and not fixed. If a change in the genetic code is permanent, it is called a mutation. If a mutation occurs in a body cell (somatic cell mutation), the mutation will be passed on to daughter cells when the cell divides.

Somatic mutations usually affect only the individual organism. When a mutation occurs in the DNA of a gamete cell (called a germ line mutation), this mutation can be passed on to the next generation of organisms. Germ line mutations are one way in which genetic variation in a population can occur. You will examine two types of mutation that can occur: point mutations and chromosomal mutations.

Point mutations occur when one of the following occurs:

• substitution of one nucleotide for another
• insertion of one or more nucleotides
• deletion of one or more nucleotides

Substitution

The effect of a substitution will depend on the actual nucleotide substituted and the subsequent effect on the protein. As you have seen in “Table 18.3” on page 637, the same amino acid may have several slightly different codes. This feature is called redundancy. A change in one of the nucleotides does not necessarily result in a different amino acid being used in the protein change; however, sometimes a different amino acid does result. Study the following examples noting the effects of a substitution mutation.

Example A

Example A is the normal mRNA nucleotide sequence and coding amino acid sequence.

UGC  AUA  AAU GGC ← mRNA

cys – iso – asp – gly ← amino acid sequence

Example B

In Example B, a C nucleotide was substituted for the A nucleotide in the second codon triplet. Both the original triplet, AUA, and the mutated triplet, AUC, code for the same amino acid, isoleucine. This type of mutation does not affect the amino acid chain or the protein produced.

UGC  AUC  AAU GGC

cys – iso – asp – gly

Example C

In Example C, the substitution of U for A in the second triplet causes a change in the amino acid in the sequence. This type of mutation can cause the protein to be less effective or to not function appropriately for a process. This is the type of mutation that causes the harmful sickle cell anemia disease. This type of mutation could also produce new types of proteins that might meet different needs.

UGC  UUA  AAU GGC

cys –  leu –  asp –  gly

Example D

In Example D, the substitution does not allow the protein to function at all. In Example D, the amino acid sequence is terminated, and the protein will be cut short and will be non-functioning.

UGA  AUA  AAU GGC

Stop*

Example E

Insertion and deletion mutations can cause a frameshift mutation. These mutations cause the entire reading frame of the gene to be altered or to shift. The result is a series of new codons for different amino acids and leftover nucleotides. Study Example E to observe the consequences of insertion. Deletion will have similar consequences in coding amino acids.

UGC  AUA  AAU GGC      NORMAL original

cys –  iso –  asp –  gly

UGC  AUGA  AAU GGC    mRNA after insertion of one nucleotide

UGC AUG AAA UGG C     frameshift caused by insertion, resulting in a new amino acid sequence

cys – met – lys - trp

Chromosomal Mutations

Chromosomal mutations are another type of mutation. As you discovered in Module 5, these mutations occur when chromosomes cross over and recombine genetic material. Other chromosomal mutations can occur if part of the chromosome is lost or duplicated during DNA replication.

Recall that non-disjunction can also result in major differences. In non-disjunction, chromosomes are not segregated correctly. The resultant cells can have too many (trisomy), or not enough (monosomy) chromosomes.

Read the section “Types of Mutations” on pages 643 to 644 of your textbook to review these different types of mutations. Choose how you will summarize this information for your course folder.

Self-Check

To confirm your understanding, complete the following questions. If you had trouble with these questions, go to the next page and watch the video in the Watch and Listen section now and review the questions again. The video may explain mutations in a different way that could help your understanding. If you still have questions, consult with your teacher.

SC 1. What feature of the genetic code helps to protect a cell from the effects of nucleotide substitution?

SC 2. What is a frameshift mutation?

SC 3. Why is a mutation caused by an insertion or a deletion more likely to have serious consequences for a cell than one caused by a substitution?

SC 4. One mutation results in the replacement of a G nucleotide with a T nucleotide in the sense strand of a DNA molecule. Under what circumstances will this substitution produce each of the following situations?

1. no change in the production of a protein
2. a new and different protein is produced that doesn’t function

SC 5. Explain the difference between a germ line mutation and a somatic cell mutation. Which type of mutation contributes more to the variations among organisms?

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Read

Some mutations are spontaneous and occur naturally in the cell. One cause of this type of mutation is incorrect base pairing by DNA polymerase during DNA replication.

Factors in our environment can also cause mutations. These mutations are referred to as induced mutations. There are two categories of mutagens that cause these induced mutations: physical and chemical. During an X-ray, the broken bone is exposed to the physical mutagen of radiation. Gasoline fumes are chemical mutagens. Read “Causes of Mutation” to the end of “Chemical Mutagens” on pages 644 to 645 of your textbook. To summarize this information, create a list of the chemical and physical mutagens, how they cause mutations, and what the outcome of the mutation can be (e.g., cancer).

Module 7: Lesson 5 Assignment

Watch and Listen

The video “Genes, Mutations and Viruses: Alterations in the Genetic Code” is an excellent review of this lesson. It reviews mutations, discusses causes of mutations, and specifically discusses sickle cell anemia.

Reflect and Connect

Mutations can be a source of genetic variation in a population. Sometimes these random changes produce variations that can be adaptive and can give the organism a competitive advantage, for example the gene for sickle cell anemia imparting a resistance to malaria. Sometimes these changes have no effect. And sometimes these changes can have damaging effects, such as cancer. To review the concepts of mutation, complete the Self-Check section.

Self-Check

Use the following information to answer SC 6 and SC 7.

SC 6. Identify the type of mutation that would occur if the first codon were changed as follows: GUU is changed to GUC.

1. frameshift mutation: This would cause the entire reading frame of a protein to be altered.
   
2. silent mutation: This would have no effect on the cell’s metabolism.

SC 7. Identify the type of mutation that would occur if the third codon were changed as follows: UUG is changed to UAGG.

1. frameshift mutation: This would cause the entire reading frame of the gene to be altered.
   
2. silent mutation: This would have no effect on the cell’s metabolism.

SC 8. What type of point mutations occurred when the third codon was changed from UUG to UAGG in SC 7?

1. substitution
   
2. insertion
   
3. deletion

SC 9. What type of point mutation occured when the second codon was changed from CAU to CAA in the question above?

1. substitution
2. insertion
3. deletion

SC 10. For a substance to be classified as a mutagen, it must cause

1. a change in DNA
2. enzymes to denature
3. protein production
4. mRNA to be produced

SC 11. Distinguish between induced mutations and spontaneous mutations.

SC 12. Distinguish between chemical mutagen and physical mutagen; then give an example of each.

Reflect on the Big Picture

The depiction of superheroes, like Bionic Woman, Superman, Spiderman, and the X-men, with new and amazing abilities, are not just factually unlikely, they are scientifically unsound. Or are they?

Discuss

Reflecting on your knowledge of DNA, replication and mutation, you are to create a discussion post that states your position on the possibility of a genetic superhero arising from the human population. What might be needed beyond the naturally occurring mutations and selection pressures to create a real genetic superhero? Justify your position and share your reflection with your teacher and your classmates in the discussion area.

Module 7: Lesson 4 Assignment

Submit your completed Module 7: Lesson 4 Assignment to your teacher for assessment.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing questions:

• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and a negative result?
• What are the causes of changes in DNA?

What is a mutant? You should now realize that everyone’s DNA is constantly changing. Can we all be considered mutants? Most of the changes or mutations have no effect on us at all, but others may have minimal or even dramatic effects on our lives. The only mutations that will affect our offspring are mutations that occur in our germ cells. When mutations occur in the germ line, future generations can continue to pass on the mutation, thus causing a new variation in the population. These variations can have a positive outcome and can give an advantage to a population, as with sickle cell anemia’s protection against malaria, or they could have a negative affect and can disadvantage a population, as with cancer.

Mutations that can occur may be point mutations and chromosomal mutations. Point mutations involve substitution, insertion, or deletion of one or more nucleotides. Chromosomal mutations involve entire sections of the chromosome in which sections can be lost or rearranged.

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

adaptive advantage: a difference in structure, physiology, or behaviour that gives an organism a better chance of survival

chemical mutagen: molecule that can enter the cell nucleus and induce a permanent change in the genetic material of the cell by reacting chemically with DNA (e.g., nitrites)

chromosomal mutation: mutation that involves the deletion, insertion, or crossing over of chromosomes

deletion: a type of point mutation where a nucleotide is removed from a DNA sequence, causing a frameshift mutation

frameshift mutation: permanent change in the genetic material of a cell caused by the insertion or deletion of one or two nucleotides, so that the entire reading frame of the gene is altered

gene pool: the total of all the alleles of all genes in the individuals in a population

germ line mutation: mutation that occurs on a gamete and can be passed to the next generation

induced mutation: permanent change in genetic material caused by a mutagen outside the cell

insertion: a type of point mutation in which one nucleotide is added to the DNA sequence, causing a frameshift mutation

mutagen: substance or event that increases the rate of mutation in an organism

mutation: a permanent change in the genetic code (DNA) of a cell

physical mutagen: agent that can forcibly break a nucleotide sequence, causing random changes in one or both strands of a DNA molecule (e.g., X-rays)

point mutation: permanent change in the genetic material of a cell that affects one or just a few nucleotides

somatic cell mutation: mutation that occurs in a body cell; passed on to daughter cells, but not to the next generation of individual organisms

substitution: a type of point mutation in which one nucleotide is switched for another nucleotide in a DNA sequence

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 5—Genetic Engineering

Get Focused

Research companies invest incredible amounts of money into equipment, staff, and research. Sometimes research leads to valuable discoveries and technologies. For example, research companies have valuable patents on specific plant and animal DNA sequences developed in their laboratories.

This valuable knowledge of DNA sequences has been used to transform DNA through genetic engineering. Genetic engineering, the process of changing a gene’s message by altering genetic material, is used to transfer a characteristic from one organism to another. For example, the silk gene from a spider that was introduced into the goat DNA resulted in silk in the goat’s milk. Genetic engineering has much controversy surrounding it and creates many questions.

Who owns your DNA? Will you always own your DNA? Who has the right to alter your DNA? The Human Genome Project has now identified the entire sequence of human DNA. How will this important knowledge be used? Will human DNA sequences also be patented? Could genetic engineering lead to changes in the variation of the human population? Could this technology be used to create superhumans or superheros? Is this even a realistic, scientifically-based question?

For additional background on genetics and society, read from page 652 to “Biotechnology Products” on page 654 in your textbook.

Throughout this lesson, you will learn about the science behind genetic engineering, and then you will apply your knowledge to some of the questions above. 

This lesson will address the following focusing questions:

• What roles do restriction enzymes and ligases play in changing the genome?
• What are some technologies involved in genetic engineering?
• What are the implications of genetic manipulation?

Module 7: Lesson 5 Assignment

The Module 7: Lesson 5 Assignment requires that you submit responses to the following:

• Part 1: Recreating the First Chimera
• Part 2: Bt Corn Research
• Part 3: Questions

Download a copy of the Module 7: Lesson 5 Assignment to your computer now. You will receive further instructions about how to complete this assignment later in the lesson.

You must decide what to do with the questions that are not marked by the teacher.

Remember that these questions provide you with the practice and feedback that you need to successfully complete this course. You should respond to all of the questions and place those answers in your course folder.

Remember, you also have the option of trying additional questions from the textbook for further practice. Consult with your teacher for the answers to these questions. The Key will also provide you with many Diploma Exam-style multiple-choice, numerical-response, and written-response questions that will be an excellent review of the module. Practising your responses to these types of questions is good preparation for the Diploma Exam.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

Genetic engineering is used in the laboratory to manipulate genetic material. Genes from plants, animals, and bacteria can be inserted into a different organism’s genetic material. Genetic engineering resulted in the goat producing silk in its milk. The gene for silk production from a spider was isolated and then inserted in the genetic material of the goat. This new combination of spider and goat DNA is called recombinant DNA. 

Researchers use restriction endonucleases, a specific group of restriction enzymes. Restriction endonucleases are able to “cut” the interior of DNA molecules within specific short sequences of nucleotides called target sequences. The actual site where the DNA is cut is called the restriction site. The target sequences and restriction sites are specific for different endonucleases.

“Figure 18.18” on page 648 shows the target sequence of GAATTC for a restriction endonuclease. Notice the restriction site within the target sequence. The small fragments of DNA created from this cleavage are called restriction fragments. If the same endonucleases are used to cut DNA from another organism, the restriction fragment’s sticky ends can base-pair with other organisms’ restriction fragments. DNA ligase can be used to splice these fragments together. Review the processes involved in genetic engineering by reading “Recombinant DNA” from page 647 to the end of page 648 in your textbook.

Watch and Listen

The animation “Restriction Endonucleases” describes restriction endonucleases, target sequences, sticky ends, and DNA ligase. It is an excellent illustration to support visual learning. Obtain a username and password from your teacher to gain access to the LearnAlberta website.

For more detail, watch “Genetic Engineering: The Science of Manipulating DNA.” Observe how students model the restriction endonuclease’s action using paper. Start at the beginning and stop viewing when you reach the section titled “Gel Electrophoresis.”

Self-Check

SC 1. To practise the concepts of genetic engineering, complete the Genetic Engineering Drag and Drop. Drag the correct label of the structure or description of the process to the numbered site where it belongs.

Read

Recreating the First Chimera

Read “Thought Lab 18.4: Recreating the First Chimera” on page 649 of your textbook and watch the animation, “Early Genetic Engineering Experiment,” which illustrates the process. Obtain a username and password from your teacher to gain access to the LearnAlberta website.

In “Thought Lab 18.4: Recreating the First Chimera,” you saw how scientists added foreign DNA (an amphibian gene) into the circular plasmid DNA of bacteria. Bacteria have been used in this way since 1982 to synthesize human insulin for the treatment of diabetes. Genetically engineered bacteria have also been used to produce other medicines such, as Human Growth Hormone to treat dwarfism and clotting factors to treat hemophilia.

Bioremediation involves using living cells to clean up the environment. For example, bacteria’s metabolic functions are genetically altered through genetic engineering to allow them to clean up soils polluted with PCBs, to clean up oil spills, to filter air from factory smoke stacks, and to remove heavy metals from water.

Genetic engineers have also been able to insert foreign DNA into plants and animals. Transgenic organisms are the result of these procedures. One example of a transgenic plant is golden rice, described in “Figure 18.22” on page 655 of your textbook. This figure shows the four different plant and fungus genes that have been added to the rice in order to increase the iron and vitamin A content of the rice. Read “Biotechnology Products” on page 654 up to “The Diagnosis and Treatment of Genetic Disorders” on page 658. Make summary notes for your course folder.

Self-Check

SC 2. To check your understanding, complete Plant Genetic Engineering. Check your answers as you go.

Module 7: Lesson 5 Assignment—Part 1

Discuss

D 1. Some genetically modified plants have been surrounded by controversy. Bt corn is a genetically modified organism (GMO) that makes up about 50% of the corn crops grown in Canada. Bt is a naturally occurring soil bacterium called Bacillus thuringiensis. This bacterium produces a protein that acts as an insecticide. Scientists isolated this protein from Bt and inserted it into the corn DNA. The resulting transgenic Bt corn produces the Bt protein insecticide, thereby killing pests feeding on the plant.

In 1999, a study from Cornell University showed that monarch caterpillars who fed on milkweed covered in Bt corn pollen grew more slowly and had higher mortality rates. News agencies picked up this story quickly, and many articles and reports resulted. There was much controversy surrounding the results of this study.

Search the Internet for reports on Bt corn and monarch butterflies using search terms such as “genetically modified + Bt corn + genetically modified food + butterflies,” or search “archives + CBC + food” for the clip on genetically modified food. Collect reports that represent the two sides of the controversy. You may wish to start a table representing the opposing views in preparation for your lesson assignment.

Module 7: Lesson 5 Assignment—Part 2

Retrieve the copy of the Module 7: Lesson 5 Assignment that you saved to your computer earlier in this lesson. Complete Part 2. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Read

Transgenic organisms other than bacteria and plants have also been created. Consider the following examples:

• goats that produce spider silk in milk for pharmaceutical products
• sheep milk that produces proteins to help treat cystic fibrosis
• cow’s milk that produces an iron transport protein that is added to infant formula
• chickens that can produce human proteins in the whites of their eggs
• mice used in biological experiments
• pigs whose organs can be donated to humans

Once one transgenic organism is produced, scientists endeavour to produce more individuals from that organism. Creating a transgenic organism is a difficult, expensive, and time-consuming task. In order for a herd of transgenic organisms to be created, scientists could wait many generations, or they can use cloning techniques to create “copies” of the transgenic organism. Cloning techniques create hundreds of identical transgenic organisms in just one generation.

Try This

There are many virtual labs on the Internet that simulate the cloning of an organism. Do an Internet search using the keywords “cloning + animation” to find a couple of simulations to try, or complete “Click and Clone.” Work through the simulation to practise and to remember the steps involved in cloning an organism.

Read

Gene Replacement Therapy

Replacing defective genes in humans is a new way to prevent and/or treat genetic disorders. This new therapy is called gene replacement therapy. This type of therapy attacks the cause of the disorder instead of treating the symptoms. Most of the research trials have concentrated on treating somatic cells (somatic gene therapy). This type of treatment can only improve the health of the individual patient.

A more controversial therapy, germ-line therapy, modifies the genetic information in the egg and sperm cells and could eliminate the disorder in offspring. Currently, germ-line therapy is banned in Canada. Read more about gene therapy, the use of DNA vectors to alter the genetic material in humans, and the controversy surrounding this new form of treatment under “Treating Human Genetic Disorders” on pages 660 and 661 of your textbook.

You may choose to review some of the diagnostic procedures, such as amniocentesis and genetic probes, that you have learned in this course by reading “The Diagnosis and Treatment of Genetic Disorders” on pages 658 to 659 of your textbook.

Module 7: Lesson 5 Assignment—Part 3

Retrieve the copy of the Module 7: Lesson 5 Assignment that you saved to your computer earlier in this lesson. Complete Part 3, which is based on the concepts you have learned in this lesson. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Discuss

Complete either D 1 or D 2.

As you do the following research, remember that technologies, their methods and uses, the controversy, and the societal issues that can surround them are often part of the open-response essay question on your Diploma Exam.

D 2. Review “Ownership of Genetic Information” on pages 653 and 654 of your textbook. Think about the following questions and create a discussion posting stating your opinions. Check out some of the other postings by your classmates and respond to at least two of the postings.

Who owns the genetic information of the transgenic organisms? Should companies have the right to sell DNA information to other companies without the permission of the people who provided the samples? Should companies that use DNA in medical research be required to share the results of their work with the individuals whose genetic information was used? What are the advantages and disadvantages of companies patenting genes like “Roundup-Ready”?

D 3. Many controversial sciences and technologies have been discussed during this lesson. Choose one example or topic that stood out for you more than all of the others. Do some extra reading on the Internet about this topic. How did this extra information affect your opinion? Create a discussion posting about the example or topic and state your opinion OR present a few interesting facts that you found during your extra research. Check out some of the other postings by your classmates, and respond to at least two of the postings.

Reflect and Connect

Think about what you have learned in this lesson. In Reflect on the Big Picture, use your knowledge to outline the steps that you would perform to have a gene inserted into or removed from your DNA.

You may want to discuss your work with your peers and teacher in the discussion area.

Reflect on the Big Picture

Imagine that you could have any gene inserted into your DNA. What would you choose? If you could get rid of any gene or genes, what would you pick? Would this help you become a superhero? What would be the societal, ethical, and medical issues related to the insertion of this gene? 

Self-Check

SC 3. Complete the Self-Check activity Transgenic Organisms. Check your answers as you complete the activity.

Module 7: Lesson 5 Assignment

Submit your completed Module 7: Lesson 5 Assignment to your teacher for assessment.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing questions:

• What roles do restriction enzymes and ligases play in changing the genome?
• What are some technologies involved in genetic engineering?
• What are the implications of genetic manipulation?

This lesson has discussed the processes and controversy involved in genetic engineering. You have learned about the steps needed for recombinant DNA, including how DNA ligase is used to join the sticky ends created at the restriction site by restriction endonucleases. You have learned about different transgenic organisms and chimeras, and you have discussed the advantages and disadvantages of these genetically altered organisms.

You have learned about the mechanisms involved in cloning and gene therapy, and you have also discussed the controversy surrounding this science. Who owns DNA was one of the final topics of discussion in this unit. Many difficult social and ethical issues were raised in this lesson, and it will be very exciting and interesting to see what the future holds for genetic engineering. In the next lesson you will see how the entire human DNA sequence was identified and how a knowledge of DNA sequences can help trace ancestral relationships.

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

bioremediation: use of living cells to perform environmental clean-up tasks, such as using bacteria to degrade PCBs into harmless compounds

chimera: a genetically engineered organism that contains DNA from unrelated species

DNA ligase: an enzyme that splices together Okazaki fragments on the lagging strand or sticky ends that have been cut by a restriction endonuclease during DNA replication

gene replacement therapy: the process of changing the function of genes to treat or prevent genetic disorders

genetic engineering: manipulation of genetic material to alter genes and blend plant, animal, and bacterial DNA

germ-line therapy: gene therapy used to modify the genetic information carried in egg and sperm cells

plasmid: small self-duplication loop of DNA in a prokaryotic cell that is separate from the main chromosome and contains from one to a few genes

recombinant DNA: a molecule of DNA that includes genetic material from different sources

restriction endonuclease: type of restriction enzyme that recognizes a specific, short sequence of nucleotides within, rather than at the ends of, a strand of DNA, and then cuts the strand at that particular point within the sequence

restriction enzyme: an enzyme that cuts DNA at specific nucleotide sequences creating fragments

restriction fragment: a small segment of DNA cut from a DNA molecule by restriction endonucleases

restriction site: a specific location within a short sequence of nucleotides in a strand of DNA where restriction endonucleases will cut

somatic gene therapy: therapy that is aimed at correcting genetic disorders in somatic (body) cells

sticky end: a short sequence of unpaired nucleotides remaining at each end of a restriction fragment on a single strand of DNA after an endonuclease makes a staggered cut at the restriction site

target sequence: in DNA replication, a short sequence of nucleotides within a strand of DNA recognized and cut by restriction endonucleases

transgenic organism: produced by incorporating the DNA from one organism into another to create a new genetic combination

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson 6—You Are Your Genetic Code

Get Focused

You may have a friend or at least know someone who has diabetes. From Unit A you will recall that this condition means blood-sugar levels can oscillate significantly leading to many complications, such as loss of vision. Medical researchers are exploring the possibility of using pancreatic pig cells to treat human diabetes. Pancreatic pig cells are transferred to a person suffering from diabetes to stimulate the production of insulin. But how is this possible without serious rejection of the transferred cells?

Human DNA is not only similar to the DNA of a pig, but also to a stalk of corn. Why are humans and corn similar? What does this mean? In this lesson you will see how similarities in DNA can be used to trace evolutionary and genetic relationships among organisms and species.

Observe the logo for the Human Genome Project—an international project whose goal is to identify the nucleotide sequence of the human genome. This lesson explores the project and how the knowledge researchers gained can be applied to the study of evolution and forensics.

This lesson will address the following focusing question:

• How can base sequences be used to trace relationships between organisms within a family and between different species?

Module 7: Lesson 6 Assignment

Your teacher-marked Module 7: Lesson 6 Assignment requires you to submit a response to the following for assessment:

• Part 1—Lab 1: DNA Fingerprint Analysis Lab
• Part 2—Write a paragraph explaining how nucleic acid in the nucleus, mitochondria, and chloroplasts can be used to trace evolutionary relationships.

Download a copy of the Module 7: Lesson 6 Assignment to your computer now. You will receive further instructions about how to complete this assignment later in the lesson.

You must decide what to do with the questions that are not marked by the teacher.

Remember that these questions provide you with the practice and feedback that you need to successfully complete this course. You should respond to all of the questions and place those answers in your course folder.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Explore

Read

Scientists from around the world have worked together on the Human Genome Project. This was a true scientific collaboration involving contributions from Canada, the US, the UK, Japan, France, Germany, China, and other countries.

The goal of the project was to identify the three billion nucleotide base pairs that make up the human genome. The project took 13 years (less then the estimated 15 years due to technology advances) and ended in 2003. The result became a “sourcebook” for medical science that helps researchers understand and treat over 4000 genetic diseases. Note the image provided of human chromosome #1 and the genes coded for by 246 million base pairs. And this is just one chromosome! How could this knowledge be useful? Some of the potential and current beneficial applications of this project include:

• molecular medicine
• energy sources and environmental applications
• risk assessment
• bioarchaeology, anthropology, evolution, and human migration
• DNA forensics (identification)
• agriculture, livestock breeding, and bioprocessing

In this lesson you will be concentrating on the evolutionary and DNA forensics applications of the findings of the Human Genome Project. If you would like further information on the other beneficial applications mentioned above, do a search on the Internet using terms “Human Genome Project” or “genomics + energy +gov + genome project + US Department of Energy.”

For more information about human genomes, click on “base pairs1.”

1 Image courtesy of the U.S. Department of Energy Genome Programs (http://genomics.energy.gov)

Watch and Listen

Watch the video “The Human Genome Project: Identity of the Future,” which explains the project’s goals, benefits, issues, and concerns. The video also introduces DNA fingerprinting, which will be discussed in the next Read section. As you watch, create a list of all of the benefits and drawbacks and/or concerns associated with the Human Genome Project. Place this list in your course folder for future reference. Contact your teacher to obtain a username and password required to access the video.

Discuss

This image is one of the many posters used to promote the Human Genome Project. The poster describes the areas or fields that will be impacted by the knowledge gained from the Human Genome Project. Choose another of these fields, other than forensics and evolution, to research. Do an Internet search for “Human Genome Project Information.”

Find out how the Human Genome Project (HGP) will, or has, impacted the field of study you have chosen. Create a one-paragraph discussion posting to share with students in your class. Discuss benefits and any disadvantages associated with the use of the HGP information.

Read

The video the “Human Genome Project: Identity of the Future” described the process and uses of DNA fingerprinting. Review the tool of DNA fingerprinting, gel electrophoresis, by reading “Sorting and Analyzing DNA” from pages 649 to  651 of your textbook. Using a diagram, flow chart, or point form, outline the steps in the gel electrophoresis procedure for your course folder.

Self-Check

Through the video and reading above you should now know that DNA fingerprinting has many uses. The most well-known use is the identification of criminals in forensics labs. Lesser-known uses for DNA fingerprinting are the identification of harmful strains of bacteria, the diagnosis of inherited disorders, management of wildlife genetic variation, and even the identification of the exact grapes used in a wine. The uses for this technology are endless. This technology is also used to identify relationships between human beings. Given that half of the nuclear DNA of a child originates from the mother and the other half is from the father, this information and DNA fingerprinting technology can be used to identify biological parents.

Try This

Real-World Applications

TR 1. Research some real examples of DNA fingerprint analysis being used to solve crimes or identify people.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Module 7: Lesson 6 Assignment

Lab: DNA Fingerprint Analysis Lab-Gizmo

Your DNA makes you “you.” No two individuals have the same DNA unless they are identical twins, triplets, and so on. In this simulation, you will be looking at the DNA fingerprints of frogs. You will use the DNA fingerprints to identify twin frogs, and you will investigate the relationship between DNA fingerprints and frog traits.

Open the DNA Fingerprint Analysis Gizmo. You may need to obtain a username and password from your instructor to gain access to the LearnAlberta website in order to view this animation.

Problem

How can identical twins and physical characteristics be identified using DNA fingerprints?

Procedure

Follow each step in the “Exploration Guide” in the DNA Fingerprint Analysis Gizmo.
 

Retrieve the copy of the Module 7: Lesson 6 Assignment that you saved to your computer earlier in this lesson. Complete Part 1. Save your completed assignment in your course folder. You will receive instructions later in this lesson about when to submit your assignment to your teacher.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Read

Evolutionary Relationships Between Species

To study how different birds were related in the 1960s, biologists would have looked at their anatomical similarities and differences. For example, they would have compared bone shape, size, and function.

Today DNA is used. Researchers know that the DNA of chimpanzees is 98% the same as human DNA, and the genetic similarity between two humans is more than 99.99%. This knowledge can be used to create a phylogenetic tree that shows the evolutionary relationships between species. Today scientists can compare the DNA of ancient plants, animals, and even bacteria with the DNA of modern organisms in order to look at the ancestry of modern organisms, the movement of populations through time, the evolution of particular disease causing bacteria, and the way that ecosystems respond to climate change.

Ancestry Within a Species

There are other types of DNA used by scientists to study ancestry: mitochondrial DNA (mtDNA) and chloroplast DNA (cpDNA). Mitochondrial and chloroplast DNA have their own DNA that is replicated, transcribed, and translated independently from the DNA in the nucleus of the cell. The theory for how these organelles became part of the cell is called the endosymbiont theory.

Typically, when fertilization occurs, the nuclear DNA of the zygote will be a combination of the two parents’ nuclear DNA. When the zygote forms, the cytoplasm and all of the cytoplasmic organelles are donated by the ovum (egg). This means that the mitochondrial DNA will be identical to the mtDNA of the mother.

Through the generations in a family tree, many men and women contribute to the nuclear DNA makeup of an individual, but only one woman contributed to the mtDNA. Your mtDNA is a copy of your mother’s, which is copied from her mother, and so on. Mutations will still occur in mtDNA over time and this mutation rate can help scientists deduce ancestry. The more similar the mtDNA between people, the closer the people are related. The more dissimilar the mtDNA, the more mutations that must have occurred, indicating more time on the evolutionary path must have elapsed or that they are not related.

Read from “Mutations and Genetic Variation” on page 645 to the end of “Genetic Variation Within Species” on page 647 of your textbook to review these concepts. Record you findings in your course folder.

Self-Check

SC 2. Why is your mitochondrial DNA identical to the mitochondrial DNA of your mother, rather than that of your father?

SC 3. Give two examples of ways that the study of DNA sequences can help scientists learn about genetic relationships, genetic variations, or evolution.

SC 4. What was the objective of the Human Genome Project?

Module 7: Lesson 6 Assignment

In a paragraph, you will explain how the base sequences in nucleic acids contained in the nucleus, mitochondrion, and chloroplasts give evidence of the relationships among organisms of different species. Check the marking rubric found in the assignment document for direction on how to prepare your paragraph.

Retrieve your copy of Module 7: Lesson 6 Assignment that you saved to your computer earlier in this lesson. Complete Part 2 involving an explanation of the use of DNA in tracing ancestory. Save your completed assignment in your course folder. You will receive instructions later in this lesson on when to submit your assignment to your teacher.

Going Beyond

Hypothesize as to how Y chromosomes could be used to trace ancestry. Would you be tracing maternal or paternal ancestry using this chromosome? Discuss your ideas with your teacher and your classmates.

Module 7: Lesson 6 Assignment

Submit your completed Module 7: Lesson 6 Assignment to your teacher for assessment.

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Lesson Summary

This lesson addressed the following focusing question:

• How can base sequences be used to trace relationships between organisms within a family and between different species?

During this lesson you have seen how the knowledge of the human genome gained through the Human Genome Project has contributed to further developments in forensics and evolution. You have seen how gel electrophoresis is used to create DNA fingerprints unique to each individual. By completing the lab and other activities, you applied your knowledge of DNA fingerprints to isolate “genes” responsible for specific traits. You were able to identify twins and the biological parents of a child. You have also read about the evidence for evolutionary relationships that can be obtained from nuclear DNA, mitochondrial DNA, and chromosomal DNA.

Because this is the last lesson in this module and in Unit C, remember to submit the following items:

• Module 7: Lesson 6 Assignment
• the Module 7 Assessment (28 marks)
• the Unit C Assessment (48 marks)

Lesson Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

chloroplast DNA (cpDNA): circular molecules of DNA found in the chloroplasts of plants; codes for the function of photosynthesis

DNA fingerprint: the pattern of bands into which DNA fragments sort during gel electrophoresis; this pattern is unique for every individual except twins and other multiple-birht people

endosymbiont theory: theory that eukaryotic cells developed by one species of prokaryote engulf another so that organelles are formed

gel electrophoresis: tool used to separate molecules according to their mass and charge; can be used to separate fragments of DNA

Human Genome Project: joint effort of thousands of researchers from laboratories worldwide that determined the sequence of the three billion pairs of nucleotides making up the human genome

mitochondrial DNA (mtDNA): DNA within the mitochondria; is genetically identical to that of the female parent because the cytoplasm of offspring is derived from the egg (ovum)

Biology 30 Learn EveryWare © 2009 Alberta Education

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Module Summary

In this module, you explored the following overarching question:

• How can the transmission of traits at the molecular level be explained by understanding the structure of DNA, its role in protein synthesis, and how it could mutate?

In this module you learned about the historical events that led to the discovery of DNA and its structure. You learned how this amazingly simple and yet complicated structure can code for genetic traits, make copies of itself, and direct the synthesis of protein (the major component of so many body parts, like the hormones you learned about in Unit A as well as enzymes).

There are enzymes that can clip DNA apart, and enzymes that put it back together in a new way. You explored sources of variation and its application in various technologies. You looked at societal, medical, and ethical issues related to the field of genetic technology, which is rapidly developing many ways to alter genetic traits and treat genetic diseases. Furthermore, you saw that DNA has the tendency to stay the same, and yet it changes through mutation. These changes are random and can result in abnormalities. They can also provide a source of variability that is the basis for evolution. You saw that you can trace relationships among organisms of different species by comparing their genetic material.

To review and summarize the concepts of Module 7, you may wish to read the Module 7 Concept Organizer. You may have saved a copy of this document when you encountered it at the beginning of Module 7. If you didn’t, you may download it now. The concept organizer provides an outline of the lessons and the focusing questions for each lesson you studied in Module 7.

Fill in the concept organizer with the ideas that you have mastered in each lesson, and show how these ideas helped you answer the focusing questions. You can use keywords, point form, or any amount of detail that meets your needs. You may choose to work from the file on your computer, print the document and work from the paper copy, or copy the outline onto a large sheet of poster paper. This is a great tool to review and use for study purposes.

Before you begin the Module Assessment, you may wish to complete some of the questions on pages 664 to 665 in your textbook as a review.

Before you begin your Unit C Assessment, you may wish to complete some of the review questions found on pages 668 to 671 of your textbook. Your teacher may suggest questions for you to complete and provide feedback about your responses.

Module Assessment

Scenario: As a hematologist, a scientist who studies various aspects of blood, you are presenting your proposed cure for the genetic condition of sickle cell anemia to investors representing drug companies. Sickle cell anemia is a genetic condition caused when DNA mutates and a protein determining the red blood cell’s (RBC) shape changes. The RBC becomes sickle shaped and can no longer carry oxygen efficiently, resulting in anemia. These investors are not scientists. Your presentation must be understandable to them. Your presentation must include the following components:

• a description of the biological and societal effects of sickle cell anemia (include a comparison of the amino acid sequences of the mutation to the normal cell and how the disease impacts quality of life)
  
  
• an explanation of how the mutation occurred relative to the DNA code, showing all steps involved, from the protein back to the DNA code
  
  
• a technical explanation of how your proposed cure would correct the DNA mutation through genetic engineering
  
  
• an explanation of why your proposal, if done at the zygote stage, would be a permanent cure

Your presentation can take the form of a PowerPoint (multimedia presentation), a video or audio recording, a live presentation, an essay, or a poster.

The following rubric will be used to assess your presentation.

Module 7—Molecular Genetics: DNA, RNA, and Protein Synthesis

Module Glossary

Consult the glossary in the textbook for other definitions that you may need to complete your work.

adaptive advantage: a difference in structure, physiology, or behaviour that gives an organism a better chance of survival

adenine (A): a nitrogenous base of the purine group; complementary base pairs with thymine

amino acid: an organic compound consisting of a carboxylic acid group, an amino group and other side groups linked together by peptide bonds to form proteins; the building blocks of proteins

anticodon: specialized base triplet located on one lobe of a transfer RNA molecule that recognizes its complementary codon on a messenger RNA (mRNA) molecule

antiparallel: describes the property by which the 5’ to 3’ phosphate bridges run in opposite directions on each strand of nucleotides in a double-stranded DNA molecule

anti-sense strand: strand of nucleotides from the double-stranded DNA molecule that is complementary to the sense strand and is not transcribed

bioremediation: use of living cells to perform environmental clean-up tasks, such as using bacteria to degrade PCBs into harmless compounds

Chargaff’s rule: in any sample of DNA, there is a constant relationship in which the amount of adenine is always approximately equal to the amount of thymine, and the amount of cytosine is always approximately equal to the amount of guanine

chemical mutagen: a molecule that can enter the cell nucleus and induce a permanent change in the genetic material of the cell by reacting chemically with DNA (e.g., nitrites)

chimera: a genetically engineered organism that contains DNA from unrelated species

chloroplast DNA (cpDNA): circular molecules of DNA found in the chloroplasts of plants; codes for the function of photosynthesis

chromosomal mutation: a mutation that involves the deletion, insertion, or crossing over of chromosomes

complementary base pairs: refers to the hydrogen-bonded, nitrogenous base pairs of adenosine and thymine, and of cytosine and guanine in the DNA double helix

codon: set of three bases that code for an amino acid or termination signal

cytosine (C): a nitrogenous base of the pyrimidine group; complementary base pairs with guanine

deletion: a type of point mutation where a nucleotide is removed from a DNA sequence, causing a frameshift mutation

deoxyribose sugar: a ring-shaped sugar; has one less oxygen than ribose sugar

DNA (deoxyribonucleic acid): a double-stranded nucleic acid molecule that governs the processes of heredity in the cells of all organisms

It is composed of nucleotides containing a phosphate group, a nitrogenous base, and deoxyribose.

DNA fingerprint: the pattern of bands into which DNA fragments sort during gel electrophoresis; this pattern is unique for every individual except twins and other multiple-birth people

DNA ligase: an enzyme that splices together Okazaki fragments during DNA replication of the lagging strand, or sticky ends that have been cut by a restriction endonuclease enzyme

DNA polymerase: an enzyme that slips into the space between two strands of DNA during replication to add DNA nucleotides in order to make complementary strands

DNA replication: the process of creating an exact copy of a molecule of DNA

double helix: spiral ladder shape of the DNA molecule, made up of two long strands of nucleotides bound together and twisted

elongation: the process of joining nucleotides to extend a new strand of DNA; relies on the action of DNA polymerase

endosymbiont theory: theory that eukaryotic cells developed by one species of prokaryote engulf another so that organelles are formed

frameshift mutation: permanent change in the genetic material of a cell caused by the insertion or deletion of one or two nucleotides, so that the entire reading frame of the gene is altered

gel electrophoresis: tool used to separate molecules according to their mass and charge; can be used to separate fragments of DNA

gene: a specific sequence of DNA that encodes a protein, tRNA, or rRNA, or that regulates the transcription of such a sequence

gene pool: the total of all the alleles of all genes in the individuals in a population

gene replacement therapy: the process of changing the function of genes to treat or prevent genetic disorders

genetic code: the order of base pairs in a DNA molecule

genetic engineering: manipulation of genetic material to alter genes and blend plant, animal and bacterial DNA

genome: the sum, or the entire DNA, carried in an organism’s cells

germ line mutation: mutation that occurs on a gamete and can be passed to the next generation

germ-line therapy: gene therapy used to modify the genetic information carried in egg and sperm cells

guanine (G): nitrogenous base of the purine group; complementary base pairs with cytosine

helicase: an enzyme that breaks segments of DNA during DNA replication; used in technologies to fragment DNA

Human Genome Project: joint effort of thousands of researchers from laboratories worldwide that determined the sequence of the three billion pairs of nucleotides making up the human genome

induced mutation: permanent change in genetic material caused by a mutagen outside the cell

insertion: a type of point mutation in which one nucleotide is added to the DNA sequence, causing a frameshift mutation

lactase: an enzyme involved in the digestion of lactose 

lagging strand: the strand that is replicated in short segments during DNA replication

leading strand: the strand that is replicated continuously in DNA replication

mitochondrial DNA (mtDNA): DNA within the mitochondria; is genetically identical to that of the female parent because the cytoplasm of offspring is derived from the egg (ovum)

mRNA (messenger RNA): strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription

mutagen: substance or event that increases the rate of mutation in an organism

mutation: a permanent change in the genetic code (DNA) of a cell; a change in the sequence of bases on the DNA molecule

nitrogen base: an organic molecule containing nitrogen; two types present in DNA: double-ringed purines (adenine and guanine) and single-ringed pyrimidines (cytosine and thymine)

nucleotide: the repeating unit (monomer) of DNA; two strings of nucleotides joined in the middle by hydrogen bonds form a DNA molecule; each nucleotide is made up of a deoxyribose sugar, a nitrogenous base, and a phosphate group

Okazaki fragments: short nucleotide fragments synthesized during DNA replication of the lagging strand

phosphate: an inorganic phosphate group (PO43–)

physical mutagen: agent that can forcibly break a nucleotide sequence, causing random changes in one or both strands of a DNA molecule (e.g., X-rays)

plasmid: small self-duplication loop of DNA in a prokaryotic cell that is separate from the main chromosome and contains from one to a few genes

point mutation: permanent change in the genetic material of a cell that affects one or just a few nucleotides

primase: an enzyme in DNA replication that forms an RNA primer, which is used as a starting point for the elongation of nucleotide chains

promoter region: during transcription, a sequence of nucleotides on the DNA molecule that tells the RNA polymerase complex where to bind

protein: organic macromolecule assembled from subunits of amino acids

protein synthesis: amino acids forming larger protein molecules under the direction of DNA

recombinant DNA: a molecule of DNA that includes genetic material from different sources

replication bubble: oval-shaped, unwound area within a DNA molecule that is being replicated

replication fork: during DNA replication, Y-shaped points at which the DNA helix is unwound and new strands develop

replication origin: specific nucleotide sequence where replication begins

restriction endonuclease: type of restriction enzyme that recognizes a specific, short sequence of nucleotides within, rather than at the ends of, a strand of DNA, and then cuts the strand at that particular point within the sequence

restriction enzyme: an enzyme that cuts DNA at specific nucleotide sequences creating fragments

restriction fragment: a small segment of DNA cut from a DNA molecule by restriction endonucleases

restriction site: specific location within a short sequence of nucleotides in a strand of DNA where restriction endonucleases will cut

RNA: ribonucleic acid; a short, single strand composed of nucleotides with a nitrogen base, ribose sugar, and phosphate group; nitrogen bases include adenine, guanine, cytosine, and uracil; has a role in protein synthesis

RNA polymerase: main enzyme that catalyzes the formation of RNA from the DNA template

RNA primer: short strand of RNA that is complementary to a DNA template and serves as a starting point for the attachment of new DNA nucleotides

semi-conservative: term used to describe replication where each new molecule of DNA contains one strand of the original complementary DNA, and one new strand, conserving half of the original molecule

sense strand: the one strand of nucleotides from the double-stranded DNA molecule that is transcribed

somatic cell mutation: mutation that occurs in a body cell; passed on to daughter cells, but not to the next generation of individual organisms

somatic gene therapy: therapy that is aimed at correcting genetic disorders in somatic (body) cells

sticky end: short sequence of unpaired nucleotides remaining at each end of a restriction fragment on a single strand of DNA after an endonuclease makes a staggered cut at the restriction site

substitution: a type of point mutation in which one nucleotide is switched for another nucleotide in a DNA sequence

target sequence: in DNA replication, a short sequence of nucleotides within a strand of DNA recognized and cut by restriction endonucleases

termination: the completion of the new DNA strands and the dismantling of the replication machine

thymine (T): nitrogenous base of the pyrimidine group; complementary base pairs with adenine

transcription: a strand of messenger RNA (mRNA) is produced that is complementary to a segment of DNA

transgenic organism: produced by incorporating the DNA from one organism into another to create a new genetic combination

translation: second stage of gene expression, in which the mRNA nucleotide sequence directs the synthesis of a polypeptide with the aid of tRNA

tRNA (transfer RNA): type of RNA that works with messenger RNA (mRNA) to direct the synthesis of a polypeptide in a process known as translation

uracil (U): a nitrogenous base found only in RNA, not DNA; replaces thymine when paired to adenine

Watson and Crick: credited with co-discovery of the structure of DNA; received the Nobel Prize for their work