Module 7 Molecular Genetics

Module 7—Genetics at the Molecular Level:DNA and RNA at Work

Introduction

Mendel never had the opportunity to look through a microscope to see a cell. The discovery of cell nuclei and DNA occurred much later on in history. In this module, you will learn about the historical events that lead up to the discovery of DNA and its structure. You will learn how this amazingly simple, and yet complicated structure can code for genetic traits, make copies of itself, and direct the synthesis of protein (the major component of so many body parts, like the hormones you learned about in Unit A, and enzymes). There are enzymes that can clip DNA apart, and enzymes that put it back together in a new way. You will explore this source of variation and its application in various technologies that can have societal, economic, and environmental implications. Furthermore, DNA has the tendency to stay the same, and yet it changes. These changes are random and can result in abnormalities. They can also provide a source of variability that is the basis for evolution. You can trace relationships among organisms of different species by comparing their genetic material. The field of genetic technology is rapidly developing many ways to alter genetic traits, treat genetic diseases, and apply our understanding. These technologies often go hand in hand with societal, medical, ethical and other issues, some of which you will have the opportunity to examine.

In this module we will explore the following overarching question:

• Can we explain the transmission of traits at the molecular level by understanding the structure of DNA, its role in protein synthesis, and how it could mutate?

Big Picture

Big Picture

It’s a bird, it’s a plane, no . . . it’s . . . it’s Superman! During your youth (and probably even today) you enjoyed playing, imitating and watching your favorite superhero take down the “bad guys”.  What made these heroes “super”? These superheroes had special powers above and beyond a regular human being. Whether it be super strength, the ability to fly, or enhanced senses, these powers were usually caused by some sort of freak accident or tragic event. In this module, you will be learn that DNA codes for all of the body’s structures and functions. Mutation can occur in your DNA, and as you explore the causes and effects of these mutations, you can decide if superheroes could ever really exist. Could Peter Parker really have been bitten by a radio-active spider and given his spider-like abilities? Could the Incredible Hulk really be recreated by exposing someone to gamma radiation? Could other, less obvious mutations occur?

Essential Questions

In this Module you will explore the following essential questions:

• What is the history of the discovery of DNA?

• What is the structure and function of DNA?

• What is the significance of finding the DNA code?

• How does DNA code our genetic message?

• How do new cells get a copy of this message?

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

• What kinds of changes in DNA can result in variation?

• How can mutations in DNA have both a positive and negative result?

• What are the causes of changes in DNA?

• What roles do restriction enzymes and ligases play in changing the genome?

• What are some technologies involved in genetic engineering?

• What are the implications of genetic manipulation?

• How can we use base sequences to trace relationships between organisms within a family and between different species?

In This Module

In this Module

Lesson 1: DNA Structure

All organisms begin life as a single cell. All of the information for forming the body parts and for controlling body processes must be stored in that single original cell. Many scientists, and various events and discoveries, led up to the identification of the molecule that holds all of this cellular information, DNA.

You will consider the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?

Lesson 2: DNA Replication

If you had the complete “Book of Life,” how would you copy it for your children? Would you write it out? Would you photocopy it? How would you know that it didn’t contain any mistakes? The DNA from the single original cell must be replicated as the cell divides. Mistakes in this replication process can be life-threatening.

You will consider the following focusing questions:

• How does DNA code our genetic message?
• How do new cells get a copy of this message?

Lesson 3: Protein Synthesis

Have you got milk “issues?” Can’t eat or drink some dairy products? Many people are not able to eat or drink dairy products because they contain lactose. One reason for this intolerance is that their bodies cannot make the enzyme lactase. Our bodies use the DNA in our cells to build all of the proteins needed to survive, including enzymes like lactase. This process is called protein synthesis.

You will consider the following focusing question:

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

Lesson 4: Changes in the Genetic Code

Do genetic superheroes really exist? It depends on your definition of “superhero”. On the African subcontinent, communities are ravaged by malaria. The genetic makeup of those communities is changing, but it isn’t changing in areas without malaria. In Africa, the gene for sickle cell anemia is increasing in frequency in the population’s gene pool. People with one copy of the sickle cell gene can survive malaria. These individuals are stronger, live longer, and pass the gene to their children. In this lesson, we will explore how random changes (mutation) can provide a source of genetic variation in a population.

You will consider the following focusing questions:

• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and negative result?
• What are the causes of changes in DNA?

Lesson 5: Genetic Engineering

Who owns your DNA? Will you always own your DNA? The Human Genome Project has now identified the entire sequence of human DNA. How will this important knowledge be used? Research companies have valuable patents on specific sequences of plant and animal DNA sequences developed in laboratories. Will they also patent human DNA sequences? This valuable knowledge of DNA sequences has been used to transform DNA through genetic engineering.

You will consider the following focusing questions:

• What roles do restriction enzymes and ligases play in changing the genome?
• What are some technologies involved in genetic engineering?
• What are the implications of genetic manipulation?

Lesson 6: You are your Genetic Code

Human DNA is similar to the DNA of a pig, and to a stalk of corn. How did we get to be similar? What does this mean? In this lesson we will see how DNA can be used to trace evolutionary and genetic relationships among organisms and species.

You will consider the following focusing question:

• How can we use base sequences to trace relationships between organisms within a family and between different species?

Lesson 3.7.1

Lesson 1—DNA Structure

Get Focused

All organisms begin life as a single cell. All of the information for forming the body parts and controlling body processes must be stored in that single original cell. As stated in The Cell Theory, cells are the

• basis of structure
• basis of function
• basis of heredity for all living things

Many scientists work and various events and experiments led up to the identification of the molecule that holds all of this cellular information, DNA (deoxyribonucleic acid). During the process of discovery, some scientists concentrated on identifying the molecule of heredity while, simultaneously, others were studying the structure of DNA. The combination of identifying DNA as the molecule of heredity and the discovery of the DNA structure allowed scientists to begin searching for the mechanisms and processes involved in passing genetic information on between generations. The discovery of DNA also caused the imaginations of comic book artists to take new directions. Once the molecule responsible for passing on all information to the next generation was identified, imagine the possibilities. What if this DNA was changed: what would happen to a person? The beginning of mutant superheroes was born.

This lesson will address the following focusing questions:

• What is the history of the discovery of DNA?
• What is the structure of DNA?

This lesson should take approximately 70 minutes to complete.

Module 7: Lesson 1 Assignment

Once you complete the learning activities in the online lesson, you can complete the online assignment.

Bio30 3.7.1 online assignment

The other questions and activities in this lesson are not marked by the teacher; however, you should still attempt all of the work offered here. They are designed to help you review important information and build key concepts that may be applied in future lessons.

Here is a tutorial video for this lesson that you can watch if it suits your learning style.  Bio30 tut# 3.7.1 Molecular Genetics Intro

The other questions in this lesson are not marked by the teacher; however, you should still answer these questions. The Self-Check and Try This questions are placed in this lesson to help you review important information and build key concepts that may be applied in future lessons.

3.7.1 page 2

Explore

Here is a video to watch: 

Crash Course - DNA

Read

The discovery of the molecule responsible for heredity took many years and the great efforts of many scientists. During the same time, other scientists were trying to determine the structure of DNA.

DNA, then known as “nucleic acid” was first isolated from the nuclei of white blood cells by Friedrich Miescher in 1869. At this time, there was no connection made between this molecule and heredity. It took experiments by Phoebus Levene, Frederick Griffith, Alfred Hershey and Martha Chase to finally prove that DNA was the molecule responsible for heredity and not protein.

While the scientists mentioned above were looking for the agent of heredity, other scientists were studying the DNA molecule more closely. Phoebus Levene first discovered that DNA was made up of chains of four different nucleotides (adenine (A), guanine (G), cytosine (C) and thymine (T). He also noted that RNA was also made up of four nucleotides but had the base uracil (U) instead of thymine (T). Levene, unfortunately, made an incorrect discovery and proposed that all nucleotides were found in the same concentration and in the same repeating order. This led scientists to believe that DNA couldn’t be the molecule of heredity. Later, when Erwin Chargraff found that adenine (A) and thymine (T) are found in equal amounts in any sample of DNA, and cytosine and guanine were also found in equal amounts (but different to A and T), Levene’s incorrect discovery was thrown out the window and Chargaff’s rule of constant relationships between A and T, and C and G were accepted. Later, the combination of Rosalind Franklin’s use of x-ray photography, and the work of James Watson and Francis Crick eventually produced the double-helix structure model of the DNA molecule.

Learn more about the contributions of the above-mentioned scientists by reading pages 624 to 627. Summarize your readings by creating a timeline that includes scientists, experiments and major discoveries that lead to the identification of the hereditary agent and the structure of the DNA molecule. Place this timeline in your course folder for further reference when studying.

Watch and Listen

The following video titled Introduction to Molecular Genetics: The Search for the Genetic Code goes over the same scientists and experiments that lead to the discovery of DNA purpose and structure as those in your textbook readings. You may choose to watch this video in place of doing the textbook readings above, OR you may use this video to review areas that are confusing for you. To view this video you may need to get a password from your instructor in order to access the LearnAlberta website.

The Structure of DNA

Watch This

Now that you have learned the history of how DNA was discovered, let's look in detail at the structure of the DNA molecule. Since DNA is a 3-D molecule, you may find it easier to visualize the structure by watching a video. The following video shows the structure of the DNA molecule. Pay attention to the double-helix shape and the arrangement of the deoxyribose sugars, phosphates and nitrogen bases in the molecule. The relationship between DNA, chromosomes and cells is also reviewed in the video. As an extra, you can also watch students perform a lab where they extract and isolate DNA from calf thymus cells—you may skip this section if your time is limited. Stop watching the video when you get to the “Replication of DNA,” this will be covered in Lesson 2. You may need to contact your instructor for a password in order to access the LearnAlberta website so that you may view this video.

OR

Read

If you prefer, you may read about the structure of DNA in your textbook on pages 628 and 629.  In this case, pay attention to the structure shown in Figure 18.6 and note the arrangement of the deoxyribose sugars, phosphates and nitrogen bases in the molecule. You should also note the definition of complementary base pairs, and the idea that the two strands of nucleotides in the double-helix run antiparallel to each other. Adding a diagram that illustrates these features to your course folder would be an excellent idea.
 

Self-Check

Answer these five self-check questions.

3.7.1 page 3

Lesson Summary

The discovery of DNA being the molecule responsible for heredity and the structural characteristics of DNA go hand in hand. Once scientists could see, and were able to closely examine, the structure of DNA, it became obvious that this molecule had to be responsible for passing our genetic information on to the next generation. Throughout this lesson you have learned about some of the many scientists that contributed to solving these scientific questions. Every experiment and discovery built on the last, pushing forward toward the eventual result – the structure and function of DNA. The double helix that Watson and Crick modeled would not have been possible without the x-ray image from Rosalind Franklin.  The complementary base pairing in Watson and Crick’s model may not even have been thought up without the information from Phoebus Levene and his identification of the four nucleotides and their respective percent compositions. In this lesson, you have learned about the history of the identification of DNA and the structure of DNA. In the next lesson you will see how DNA’s structure directly determines its function.

Glossary

Antiparallel: describes the property by which the 5’ to 3’ phosphate bridges run in opposite directions on each strand of nucleotides in a double-stranded DNA molecule

Chargaff’s Rule:  in any sample of DNA, a constant relationship in which the amount of adenine is always approximately equal to the amount of thymine, and the amount of cytosine is always approximately equal to the amount of guanine

Complementary base pairs: refers to the hydrogen bonded, nitrogenous base pairs of adenosine and thymine, and of cytosine and guanine in the DNA double helix

DNA: deoxyribonucleic acid (DNA), a double-stranded nucleic acid molecule that governs the processes of heredity in the cells of all organisms: composed of nucleotides containing a phosphate group, a nitrogenous base and deoxyribose

Double-helix: spiral shape most commonly associated with DNA, made up of two long strands of nucleotides bound together and twisted

Lesson 3.7.2

Lesson 2—DNA Replication

Get Focused

If you had the complete “Book of Life,” how would you copy it for your children?  Would you write it out? Would you photocopy it? How would you know that it didn’t contain any mistakes? The DNA from the single original cell must be replicated as the cell divides. Mistakes in this replication process can be life-threatening. In lesson one, you learned the structure of DNA. This structure allows for a fantastic way of copying all of the hereditary information of the cell called DNA replication. In lesson 4, you will however learn that this process isn’t perfect. Mistakes do happen. Could superheroes be created through these mistakes? Keep this question in mind as you move through the lesson.

This lesson will address the following focusing questions:

• How does DNA code our genetic message?

• How do new cells get a copy of this message?

This lesson should take approximately 60 minutes to complete.

Module 7: Lesson 2 Assignment

Once you have completed the learning activities for this lesson, please complete the online assignment.

Bio30 3.7.2 online assignment

The other questions and activities in this lesson are not marked by the teacher; however, you should still attempt all of the work offered here. They are designed to help you review important information and build key concepts that may be applied in future lessons.

Here is a tutorial video for this lesson that you can watch if it suits your learning style.  Bio30 tut#3.7.2 Replication and Transcription

3.7.2 page 2

Module 7—Genetics at the Molecular Level: DNA and RNA at Work

Read

Genome: the sum, or all of the DNA carried in an organism’s cells

DNA replication: the process of creating an exact copy of a molecule of DNA

Semi-conservative: term used to describe replication where each new molecule of DNA contains one strand of the original complementary DNA, and one new strand, conserving half of the original molecule

Replication origin: specific nucleotide sequence where replication begins

Replication bubble: oval-shaped, unwound area within a DNA molecule that is being replicated
Replication fork: during DNA replication, Y-shaped points at which the DNA helix is unwound and new strands develop

In Module 1, you learned that when a cell divides to form 2 new cells, it must replicate, or make a copy of all of its DNA – the entire genome! In the last lesson you began learning about this DNA replication method by studying the structure of the DNA molecule. The double stranded structure of DNA leads to a special copying mechanism which Watson and Crick did notice. When a cell creates copies of its DNA by way of DNA replication, the new molecules of DNA each contain one of the original strands of the DNA. This makes replication a semi-conservative process. Examine figure 18.8 on page 631 to see how one strand of the original “blue” DNA is found in each of the new copies of DNA.

 

Initiation of DNA Replication

DNA replication begins at the replication origin, a specific nucleotide sequence that the enzyme helicase can bind to on the DNA. The helicase enzyme cuts (cleaves) the DNA and unravels part of the double helix. The oval-shaped area created by the unwound double helix is called the replication bubble, and at each end of this oval is a Y-shaped area called a replication fork. View figure 18.9 on page 631 to visualize these areas. The single strands in the replication bubble act as a template for creating the new copy strands of DNA (the pink strands in "Figure 18.9").

 

Elongation and Termination

Elongation of the new DNA strand occurs when the enzyme DNA polymerase adds nucleotides to the template strands inside the replication bubble. An RNA primer must first be constructed by the enzyme primase before DNA polymerase can do its job. This is because DNA polymerase can only add nucleotides to an existing free 3’ hydroxyl end of a nucleotide chain. Once the primer is in place, DNA polymerase is able to attach a nucleotide to the free 3’ hydroxyl end of the primer. You can see the –OH (hydroxyl group) on carbon 3’ in the Figure 18.3 on page 626. DNA polymerase then removes the RNA primer.

 

Elongation: the process of joining nucleotides to extend a new strand of DNA; relies on the action of DNA polymerase

DNA polymerase: an enzyme that slips into the space between two strands of DNA during replication to add nucleotides in order to make complementary strands

RNA primer: short strand of RNA that is complementary to a DNA template and serves as a starting point for the attachment of new nucleotides

Primase: enzyme in DNA replication that forms a primer which is used as a starting point for the elongation of nucleotide chains

Leading strand: that strand that is replicated continuously in DNA replication

Lagging Strand: the strand that is replicated in short segments during DNA replication

Okazaki fragments: short nucleotide fragments synthesized during DNA replication of the lagging strand

DNA ligase: enzyme that splices together Okazaki fragments during DNA replication of the lagging strand, or sticky ends that have been cut by a restriction endonuclease

Termination: the completion of the new DNA strands and the dismantling of the replication machine

Think back to the structure of DNA. The two complimentary strands are joined together in the opposite directions. Take a look at "Figure 18.10" on page 632 and notice how one strand is in the 3’ to 5’ direction while the complimentary strand is in the 5’ to 3’ direction. Since DNA polymerase can only add nucleotides in the 5’ to 3’ direction, only one strand can be added to continuously. This strand is called the leading strand. The other strand of DNA is called the lagging strand and must be replicated in short segments called Okazaki fragments. These fragments are spliced together by an enzyme called DNA ligase.

 

Multiple primers are needed on the lagging strand. Eventually, DNA polymerase will remove the RNA primers and fill in the space to attach the neighbouring DNA strands. DNA polymerase is also responsible for proof reading as each nucleotide is added to the new strand. The process described above is very well illustrated in the animations below. DNA replication stops when the new completed DNA strands separate from one another. This is called termination. You should also read pages 629 to 632 of your textbook for more details.

 

You should make summary notes, a flow chart of events, or labeled diagrams to illustrate these processes. This would be important information to add to your course folder for review.

 

Watch and Listen

 Watch the following video to view a thorough overview of DNA replication. Begin this video at the section titled “DNA replication – part I”, and end at the “Mutation” section.

 

Self-Check

SC 2. What would the complementary RNA primer be if the DNA single strand had the following nucleotide sequence →   CGA

 

Check your work.

3.7.2 page 3

Lesson Summary

You will now see how the structure of DNA has lead directly to its ability to be copied and passed on to the new cells during cell division. The double-stranded DNA can unwind and serve as two template strands. New strands of DNA form to compliment these template strands. Two new, identical molecules of DNA result.  Since an original strand of DNA is found in each new DNA molecule, the process is considered semi-conservative.

In this lesson you looked at four important enzymes and how they function in DNA replication. You have learned the difference between the leading and lagging strands, and how elongation differs on each of these strands. Throughout this lesson you were asked to think about where errors could occur, causing mistakes in DNA replication. In Lesson 4, these mistakes will be discussed in more detail. In the next lesson, you will see how the DNA structure codes for, and is used to build proteins that our cells and bodies use in different structures and to fulfill various functions. Do not confuse the process of DNA replication that you have learned about in this lesson with the process of translation to be discussed in Lesson 3.

Glossary

DNA ligase: enzyme that splices together Okazaki fragments during DNA replication of the lagging strand, or sticky ends that have been cut by a restriction endonuclease

DNA polymerase: an enzyme that slips into the space between two strands of DNA during replication to add nucleotides in order to make complementary strands

DNA replication: the process of creating an exact copy of a molecule of DNA

Elongation: the process of joining nucleotides to extend a new strand of DNA; relies on the action of DNA polymerase

Genome: The sum, or all of the DNA carried in an organism’s cells

Lagging Strand: the strand that is replicated in short segments during DNA replication

Leading strand: that strand that is replicated continuously in DNA replication

Okazaki fragments: short nucleotide fragments synthesized during DNA replication of the lagging strand

Primase: enzyme in DNA replication that forms a primer which is used as a starting point for the elongation of nucleotide chains

Replication bubble: oval-shaped, unwound area within a DNA molecule that is being replicated

Replication fork: during DNA replication, Y-shaped points at which the DNA helix is unwound and new strands develop

Replication Origin: specific nucleotide sequence where replication begins

RNA primer: short strand of RNA that is complementary to a DNA template and serves as a starting point for the attachment of new nucleotides

Semi-conservative: term used to describe replication where each new molecule of DNA contains one strand of the original complementary DNA, and one new strand, conserving half of the original molecule

Termination: the completion of the new DNA strands and the dismantling of the replication machine

Lesson 3.7.3

Lesson 3—Protein Synthesis

Get Focused

Have you got milk “issues”? Can’t eat or drink some dairy products? Many people are not able to drink dairy products because they contain lactose. One reason for the intolerance is that their bodies are not able to produce the enzyme lactase. Having the genetic code in our cells may not be enough. The instruction on our chromosomes must be expressed. The genes found on our chromosomes code for proteins that are needed for our survival. The gene for lactase and other proteins is expressed through a process called protein synthesis. We cannot survive without proteins. As was previously mentioned, some humans can’t make certain proteins, like lactase for instance. But what would happen if we could make extra proteins? For instance, like having the ability to make silk, as Spiderman does. Some goats in Quebec have that ability, maybe one day we will too!

This lesson will address the following focusing question:

• How is the genetic code in DNA copied and used to assemble amino acids into proteins?

This lesson should take approximately 90 minutes to complete.

Module 7: Lesson 3 Assignment

You will complete questions on a RNA and protein synthesis simulation and an assignment on transcription in reverse for assessment.

Once you have completed all of the learning activities for this lesson, you can complete the online assignment.

Bio30 3.7.3 online assignment

The other questions and activities in this lesson are not marked by the teacher; however, you should still attempt all of the work offered here. They are designed to help you review important information and build key concepts that may be applied in future lessons.

Here is a tutorial video for this lesson that you can watch if it suits your learning style. 

3.7.3 page2

Explore

Here is a video to watch: 

Crash Course - Protein

Read

DNA has a very important purpose. It contains all of the genetic code needed to build an organism. The order of the nucleotides in DNA provides the code that determines how the amino acids must be strung together to build a protein. A gene is a sequence of nucleotides on the DNA strand that codes for the production of one or more proteins. To express a gene, the genetic information is passed down from DNA, to RNA, to protein. Passing the genetic information from DNA to RNA is called transcription. Translation is the term to describe the process of passing the message from RNA to protein. Both processes will now be explained in detail.

Transcription

Transcription takes place in the nucleus, and is dependent on one type of RNA: mRNA (messenger RNA). The DNA molecule remains in the nucleus and the information or code for a gene is copied onto mRNA. Messenger RNA is a single strand of RNA coded from one strand of the DNA molecule called the sense strand. The other strand, which is not coded, is called the anti-sense strand. Take a look at figure 18.13 on page 638 of the textbook to see the difference between the sense and anti-sense strands. RNA polymerase is the enzyme that binds to the DNA strand at the promoter region. RNA polymerase then opens the DNA double helix and builds a strand of mRNA (in the 5’ to 3’ direction) that is complementary to the DNA sense strand.  When the stop signal is reached, the RNA polymerase detaches from the DNA strand and the DNA double helix reforms. You can read more about transcription in your textbook on pages 636 to 638, or if you prefer, you can watch the video below to review transcription. You may wish to make summary notes, labeled diagrams, or flow charts to add to your study notes for later review.

Watch and Listen

The following video is a good review of the transcription process. Watch the sections titled “DNA and RNA” and “Bio Discovery: Transcription”. You may need to contact your instructor in order to get a password and username to access the LearnAlberta website. 

Try This #1

A DNA strand contains the following nucleotide sequence: 

TACTGCCTCCCCATAAGAATT

What is the nucleotide sequence of the mRNA strand that is transcribed from this DNA template?

Read

Translation

Translation is the process of turning the mRNA sequence into an amino acid chain (protein).  The mRNA codons determine which amino acid will be added to the chain. A codon is a set of three bases. For example, the codon ACU codes for the amino acid threonine. Look at table 18.3 on page 637 of your textbook to see a table of mRNA codons and the corresponding amino acid for each. Read p. 636 and 637 “The Genetic Code” in your textbook to understand the three important characteristics of the genetic code, and to learn how you use this table. For exams, including the Diploma exam, you will always be provided with this table.

Look back to the Try This question above. You determined the mRNA base sequence to be AUGACGGAGGGGUAUUCUUAA. 

To translate this base sequence into an amino acid sequence, first separate the sequence into 3 nucleotide codons (each nucleotide can only be used in one codon) as shown:

AUG  ACG  GAG  GGG  UAU  UCU  UAA

The first codon, AUG, codes for methionine (or start). Use the chart on page 637 for help in identifying the amino acids.

The second codon, ACG, codes for the amino acid threonine.

The third codon, GAG, codes for the amino acid glutamate.

Try This #2

1. Use the table 18.3 on p. 637 to find the amino acid that corresponds to each of the following codons.
   
   
   1. GGG
   2. UCU
   3. AGU
2. What is one RNA codon that corresponds to a “stop” signal?
3. How many different codons correspond to the amino acid leucine?

Read

Translation of the messenger RNA occurs in the cytoplasm of the cell, with the help of transfer RNA (tRNA). One side of the tRNA contains the anticodon that is complementary to the mRNA codon, the other side is a binding site for the amino acid that corresponds to the codon. Figure 18.14 on page 639 shows a tRNA molecule that carries the amino acid arginine. 

Ribosomes, which contain ribosomal RNA (rRNA), help by bringing together the tRNA strand, the mRNA strand and other enzymes needed to build the protein. The initiator or start codon on the mRNA is AUG. Read through Figure 18.15 to see the steps that translation follows.

3.7.3 page 3

Watch and Listen

Watch the video describing the translation process instead of reading the textbook pages 638 to 640. There is also a great animated review of transcription and translation at the end of the video. You may need to contact your instructor in order to get a password and username to access the Learn Alberta website.

Module 7: Lesson 3 Assignment

RNA and Protein Synthesis Simulation

Open the “RNA and Protein Synthesis Gizmo.” Read carefully through the “exploration guide” and follow the steps described.

Self-Check

Complete the following Self-Check activity.

Reflect on the Big Picture

Spiderman may not exist in real-life, but spider goats do!  Some goats in Quebec have been genetically altered to produce spider silk in their milk. The spider silk gene was sequenced to find the DNA code and then inserted in the goats DNA in a way that it would only be expressed in the milk. There is no web spinning by these goats but the silk is definitely useable. Why would scientists want to do this?  What advantages and disadvantages do you see? Could this be done in humans? Could Spiderwoman actually exist? Do some research on the Internet with the key words “spider goats.” Get a good variety of differing opinions and thoughts and then write a response to the questions presented earlier in this paragraph. Share your response with your classmates.

3.7.3 page 4

Lesson Summary

This lesson explained the steps involved in producing what our DNA codes for proteins. Transcription of the DNA into mRNA in the nucleus must first occur. The mRNA then travels to the cytoplasm to ribosomes for translation to occur. During translation, the tRNA with complementary anticodons to the mRNA codons are matched up. Each tRNA brings with it an amino acid and with the help of enzymes amino acids are bonded and the coded sequence of amino acids is created. In the next lesson we will be looking at changes in the genetic code and how these changes in DNA can affect the proteins being synthesized.

Glossary

amino acid: an organic compound consisting of a carboxylic acid group, an amino group and other side groups linked together by peptide bonds to form proteins; the building blocks of proteins

anticodon: specialized base triplet located on one lobe of a transfer RNA (tRNA) molecule that recognizes its complementary codon on a messenger RNA (mRNA) molecule

anti-sense strand: strand of nucleotides from the double-stranded DNA molecule that is complementary to the sense strand and is not transcribed

codon: set of three bases that code for an amino acid or termination signal

gene: a specific sequence of DNA that encodes a protein, tRNA, rRNA or regulates the transcription of such a sequence

genetic code: the order of base pairs in a DNA molecule

messenger RNA (mRNA): strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription

promoter region: during transcription, a sequence of nucleotides on the DNA molecule that tells the RNA polymerase complex where to bind

protein: organic macromolecule assembled from subunits of amino acids

RNA polymerase: main enzyme that catalyzes the formation of RNA from the DNA template

sense strand: the one strand of nucleotides from the double-stranded DNA molecule that is transcribed

transcription: a strand of messenger RNA (mRNA) is produced that is complementary to a segment of DNA

transfer RNA (tRNA): type of RNA that works with messenger RNA (mRNA) to direct the synthesis of a polypeptide in a process known as translation

translation: second stage of gene expression, in which the mRNA nucleotide sequence directs the synthesis of a polypeptide with the aid of tRNA

Lesson 3.7.4

Lesson 4—Changes in the Genetic Code

Get Focused

Do genetic superheroes exist? It depends on your definition of “superhero.” On the African subcontinent, communities are ravaged by malaria. The genetic makeup of those communities is changing, but it isn’t changing in the areas without malaria. In Africa, the gene for sickle cell anemia is increasing in frequency in the population’s gene pool. People with one copy of the sickle cell gene can survive malaria. These individuals are stronger, live longer, and pass the gene to their children. In this lesson we will explore how random changes (mutations) can be a source of genetic variation in a population. Sometimes these variations can be adaptive and give the organism a competitive advantage.

This lesson will address the following focusing questions:

• What kinds of changes in DNA can result in variation?
• How can mutations in DNA have both a positive and negative result?
• What are the causes of changes in DNA?

This lesson should take approximately 90 minutes to complete.

Module 7: Lesson 4 Assignment

There is no assignment for this lesson but you are still responsible for the content of the lesson for test purposes.

Here is a tutorial video for this lesson that you can watch if it suits your learning style.  Bio30 tut# 3.7.4 Mutation

3.7.4 page 2

Read

The structure of DNA is not permanent. It is actually constantly changing. Enzymes like DNA polymerase repair many changes immediately, but many are missed and not fixed. If a change is permanent it is called a mutation. If a mutation occurs in a body cell (somatic cell mutation), the mutation will be passed on to daughter cells when the cell divides, therefore likely only affecting the individual organism. When a mutation occurs in the DNA of a gamete cell (germ line mutation), this mutation will be passed on to the next generation of organisms. Germ line mutations are one way that genetic variation in a population can occur. Some of the different types of mutations that can occur are described below.

Point mutations occur when one of the following occurs:

• substitution of one nucleotide for another
• insertion of one or more nucleotide
• deletion of one or more nucleotides

Substitution

The effect of a substitution will depend on the actual nucleotide substituted and the subsequent effect on the protein. We will use the example below to see what the effects of a substitution mutation can be. Example A is the normal mRNA nucleotide sequence and coding amino acid sequence.

Example A

UGC  AUA  AAU GGC ← mRNA

cys – iso – asp – gly ← amino acid sequence

Example B

UGC  AUC  AAU GGC
cys – iso – asp – gly

In Example B above, a C nucleotide was substituted for the A nucleotide in the second codon triplet. Both the original triplet AUA and the mutated triplet AUC code for the same amino acid, isoleucine. This type of mutation, where the protein or amino acid chain is not affected, is called a silent mutation.

In Example C below, you can see that the substitution of U for A in the second triplet does cause a change in the amino acid coded for this time. This type of mutation is called a mis-sense mutation and can cause the protein to not work, or to be less effective. This is the type of mutation that causes the harmful sickle cell anemia disease. This type of mutation could also develop new forms of proteins that might meet different needs.

Example C

UGC  UUA  AAU GGC

cys –  leu –  asp –  gly

Example D

UGA  AUA  AAU GGC

Stop*

Some substitutions like the one in example D don’t allow the protein to function at all. In example D, the amino acid sequence is terminated and the protein will be cut short and be non-functioning. This is an example of a non-sense mutation.

Insertion and deletion mutations can cause a frameshift mutation. These mutations cause the entire reading frame of the gene to be altered, and results in a nonsense mutation. Take a look at example E below.

Example E

UGC  AUA  AAU GGC      NORMAL original
cys –  iso –  asp –  gly

UGC  AUGA  AAU GGC    mRNA after insertion of one nucleotide
 

UGC AUG AAA UGG C     frameshift caused by insertion, resulting new amino acid sequence
cys – met – lys - trp

Chromosomal mutations are another type of mutation that you looked at earlier in this module. These mutations occur when chromosomes cross over and recombine genetic material. Other chromosomal mutations can occur if part of the chromosome is lost, or duplicated during DNA replication. Remember that another event can result in major differences. That event is non-disjunction, as you learned in a previous lesson. In non-disjunction, because chromosomes are not segregated correctly, cells can result that have too many (trisomy), or not enough (monosomy) chromosomes.

Read pages 643 and 644 to review these different types of mutations.

Self-Check

Answer the following questions, then compare your answer to the suggested responses. How was your understanding of the different types of mutations? If you had trouble with these questions, contact your instructor and skip ahead to watch the video near the end of this lesson. The video may explain mutations in a different way that could help your understanding.

1. What feature of the genetic code helps to protect a cell from the effects of nucleotide substitution?
2. What is a frameshift mutation?
3. Why is a mutation caused by an insertion or a deletion more likely to have serious consequences for a cell than one caused by a substitution?
4. One mutation results in the replacement of a G nucleotide with a T nucleotide in the sense strand of a DNA molecule. Under what circumstances will this substitution produce each of the following mutations?
   
   
   1. A silent mutation
   2. A mis-sense mutation
   3. A nonsense mutation
5. Explain the difference between a germ line mutation and a somatic cell mutation. Which type of mutation contributes more to the variations among organisms?

3.7.4 page 3

Read

Causes of Mutations

Some mutations are spontaneous and occur naturally in the cell. One cause of this type of mutation is incorrect base pairing by DNA polymerase during DNA replication.

Factors in our environment can also cause mutations; these mutations are referred to as induced mutations. There are two categories of mutagens that cause these induced mutations: physical and chemical. You have likely been exposed to the physical mutagen, x-rays, if you have ever broken a bone. Learn more about physical and chemical mutagens by reading pages 644 and 645 of your textbook. As you read, create a list to organize the chemical and physical mutagens you discover. In your list, describe how they cause mutations and what the outcome of the mutation can be (ie. Cancer). Search the Internet and view the video below to help you add to this list. Place this list in your course folder for future reference when studying.

Watch and Listen

Watch the following video titled Genes, Mutations and Viruses: Alterations in the Genetic Code as it is an excellent review of this lesson. It shows animations of mutations, discusses causes of mutations, and even specifically mentions Sickle-cell anemia.

Reflect and Connect

Self-Check

Use the following information to answer the next two questions.

1. Identify the type of mutation that would occur if the first codon was changed as shown below: GUU is changed to GUC
   
   
   1. frameshift mutation: this would cause the entire reading frame of a protein to be altered
   2. nonsense mutation: this would render the protein unable to code for a functional gene
   3. silent mutation: this would have no effect on the cell’s metabolism
   4. mis-sense mutation: this would result in an altered DNA molecule
2. Identify the type of mutation that would occur if the third codon was changed as shown: UUG is changed to UAGG
   
   
   1. frameshift mutation: this would cause the entire reading frame of the gene to be altered
   2. nonsense mutation: this would render the gene unable to code for a functional polypeptide
   3. silent mutation: this would have no effect on the cell’s metabolism
   4. mis-sense mutation: this would result in an altered protein
3. What type of point mutations occurred when the third codon was changed from UUG to UAGG in the question above?
   
   
   1. substitution
   2. insertion
   3. deletion
4. Identify the type of mutation that would occur if the second codon was changed from CAU to CAA
   
   
   1. frameshift mutation: this would cause the entire reading frame of the gene to be altered
   2. nonsense mutation: this would render the gene unable to code for a functional polypeptide
   3. silent mutation: this would have no effect on the cell’s metabolism
   4. mis-sense mutation: this would result in an altered protein
5. What type of point mutation occurs when the second codon was changed from CAU to CAA in the question above?
   
   
   1. substitution
   2. insertion
   3. deletion
6. For a substance to be classified as a mutagen, it must cause
   
   
   1. a change in DNA.
   2. enzymes to denature.
   3. protein production
   4. mRNA to be produced
7. Distinguish between induced mutations and spontaneous mutations.
8. Distinguish between chemical mutagen and physical mutagen, then give an example of each.

Discussion

Look through some of your classmates’ mutagen summaries. Were any mutagens more commonly summarized? Where any mutagens unfamiliar to you? Choose one summary by another student/group and read it in detail. After having read this summary, think of two questions that you would like answered. Send these questions to the student/group to answer.

Module 7: Lesson 4 Assignment

There is no assignment for this lesson.

3.7.4 page 4

Lesson Summary

Mutants, who are they anyway? After going through this lesson you should realize that everyone’s DNA is changing all of the time. Can we all be considered mutants? Most of the changes or mutations have no effect on us at all (as in silent mutations), but some may have minimal or dramatic effects on our lives (as with mis-sense or nonsense mutations). The only mutations that will affect our offspring are mutations that occur in our germ cells. When mutations occur in the germ line, future generations can continue to pass on the mutation causing a new variation in the population. These variations can have positive outcome and give an advantage to a population, as with sickle-cell anemia’s protection against malaria, or they could have a negative affect and disadvantage a population, as with cancer.

Glossary

chemical mutagen: molecule that can enter the cell nucleus and induce a permanent change in the genetic material of the cell by reacting chemically with DNA (eg. Nitrites)

chromosomal mutation: mutation that involves the deletion, insertion, crossing over of chromosomes

deletion: a type of point mutation where a nucleotide is removed from a DNA sequence, causing a frameshift mutation

frameshift mutation: permanent change in the genetic material of a cell caused by the insertion or deletion of one or two nucleotides so that the entire reading frame of the gene is altered

induced mutation: permanent change in genetic material caused by a mutagen outside the cell

insertion: a type of point mutation where a nucleotide is added to the DNA sequence, causing a frameshift mutation

mutagen: substance or event that increases the rate of mutation in an organism

mis-sense mutation: permanent change in the genetic material of a cell that results in a slightly altered but still functional protein

nonsense mutation: permanent change in the genetic material of a cell that renders a gene unable to code for a functional protein

physical mutagen: agent that can forcibly break a nucleotide sequence, causing random changes in one or both strands of a DNA molecule (eg X-rays)

point mutation: permanent change in the genetic material of a cell that affects one or just a few nucleotides

silent mutation: permanent change in the genetic material of a cell that has no effect on the function of the cell

substitution: a type of point mutation where a nucleotide is switched for another nucleotide in a DNA sequence

Lesson 3.7.5

Lesson 5—Genetic Engineering

Get Focused

Who owns your DNA? Will you always own your DNA? Who has the right to alter it? The Human Genome Project has now identified the entire sequence of human DNA. How will this important knowledge be used? Research companies have valuable patents on specific plant and animal DNA sequences developed in laboratories. Will they also patent human DNA sequences? This valuable knowledge of DNA sequences has been used to transform DNA through genetic engineering. Could genetic engineering lead to changes in the variation of the human population? Could this technology be used to create superhumans or superheros?  Is this even a realistic, scientifically based question? Genetic engineering has much controversy surrounding it and creates many questions, as you can see above! Throughout this lesson, you will learn of the science behind genetic engineering, and then apply your knowledge to some of these questions. 

This lesson will address the following focusing questions:

• What roles do restriction enzymes and ligases play in changing the genome?

• What are the implications of genetic manipulation?

This lesson should take approximately 120 minutes to complete.

Module 7: Lesson 5 Assignment

You will complete the following activities for assessment.

• Recreating the First Chimera

• Bt Corn Discussion Posting
• Review Questions

Once you have completed the learning activities for this lesson, you can complete the online assignment.

Bio30 3.7.5 online assignment

The other questions and activities in this lesson are not marked by the teacher; however, you should still attempt all of the work offered here. They are designed to help you review important information and build key concepts that may be applied in future lessons.

Here is a tutorial video for this lesson that you can watch if it suits your learning style.  Bio30 tut#3.7.5 Genetic Engineering

3.7.5 page 2

Read

Genetic engineering is used in the laboratory to manipulate genetic material.  Genes from plants, animals, and bacteria can be inserted into a different organism’s genetic material. In the last lesson, an example of a goat producing silk in its milk was described. That is an example of genetic engineering. The gene for silk production from a spider was isolated and then inserted in the genetic material of the goat. This new combination of spider and goat DNA is called recombinant DNA. 

Researchers will use restriction endonucleases, a specific group of restriction enzymes that are able to “cut” the interior of DNA molecules within specific short sequences of nucleotides called target sequences. The actual site where the DNA is cut is called the restriction site. The target sequences and restriction sites are specific for different endonucleases. Figure 18.18 on page 648 shows the target sequence of GAATTC for a restriction endonuclease. Notice the restriction site within the target sequence. The small fragments of DNA created from this cleavage are called restriction fragments. If the same endonucleases are used to cut DNA from another organism, the restriction fragment’s sticky ends can base-pair with other organisms’ restriction fragments. DNA ligase can be used to splice these fragments together. Review the processes involved in genetic engineering by reading pages 647 to 648 in your textbook.

Watch and Listen

 This video titled Genetic Engineering: The Science of Manipulating DNA goes through genetic engineering in more detail.

As you watch the video, pay particular attention to how the students model the restriction endonuclease’s action using paper. Stop viewing when you reach the section about “gel electrophoresis.”

Module 7: Lesson 5 Assignment—Part 1

Recreating the First Chimera

Read "Thought Lab 18.4: Recreating the First Chimera”.

Read

In the above “Recreating the First Chimera” assignment, you saw how scientists added foreign DNA (an amphibian gene) into the circular plasmid DNA of bacteria. Bacteria have been used in this way since 1982 to synthesize human insulin to treat diabetes. Genetically engineered bacteria have also been used to produce other medicines such as Human Growth Hormone to treat dwarfism, and clotting factors to treat hemophilia. Bioremediation is another of use of genetically altered bacteria. Bacteria’s metabolic functions can be enhanced through genetic engineering to allow them to clean up soils polluted with PCBs, clean up oil spills, filter air from factory smoke stacks and remove heavy metals from water.

Genetic engineers have also been able to insert foreign DNA into plants and animals. Transgenic organisms are the result of these procedures. One example of a transgenic plant is golden rice, described in figure 18.22 on page 655 of your textbook. This figure shows the 4 different plant and fungus genes that have been added to this rice in order to increase its iron and vitamin A content. Read more about transgenic plants on page 655 and answer the following question to check your understanding.

Self-Check

Complete this Self-Check activity.

Discuss

Some genetically modified plants have much controversy surrounding them. Bt corn is a genetically modified organism (GMO) that makes up about 50% of the corn crops grown in Canada. Bt is a naturally occurring soil bacterium called bacillus thuringiensis that produces a protein that acts as an insecticide.  Scientists isolated this protein from Bt and inserted it into the corn DNA. The resulting transgenic Bt corn produces the Bt protein insecticide, therefore killing pests feeding on the plant. In 1999, a study from Cornell University showed that monarch caterpillars who fed on milkweed covered in Bt corn pollen grew more slowly and had higher mortality rates. News agencies picked up this story quickly, and many articles and reports resulted. Search the internet for a report. about this study. There was much controversy surrounding the results of this study.

3.7.5 page 3

Module 7—Genetics at the Molecular Level:DNA and RNA at Work

Read

Transgenic organisms other than bacteria and plants have also been created. A few examples of these transgenic organisms are listed below:

• goats that produce spider silk in milk for pharmaceutical products
• sheep milk that produces proteins to help treat cystic fibrosis
• cow’s milk that produces an iron transport protein that is added to infant formula
• chickens that can produce human proteins in the whites of their eggs
• mice used in biological experiments
• pigs whose organs can be donated to humans

Once a transgenic organism is produced, scientists will likely want to produce more of that organism. Creating a transgenic organism is a difficult, an expensive and a time-consuming task. In order for a herd of transgenic organisms to be created, scientists could wait many generations, or they can use cloning techniques to create “copies” of the transgenic organism. Cloning techniques allow for the ability to create hundreds of transgenic organisms in just one generation.

Cloning an organism uses specific somatic (body) cells from the genetic donor (animal you want to clone) and transplants the nuclei of these cells into the egg cells (with nuclei removed) of another organism. The resulting embryos are implanted into a surrogate mother. Read more about the cloning process on pages 655 and 656 in your textbook.

Read

Gene Replacement Therapy

Replacing defective genes in humans is a new way to prevent and/or treat genetic disorders. This new therapy is called gene replacement therapy. This type of therapy attacks the cause of the disorder instead of treating the symptoms. Most of the research trials have concentrated on treating somatic cells (somatic gene therapy). This type of treatment can only improve the health of the individual patient. A more controversial therapy, germ-line therapy modifies the genetic information in the egg and sperm cells and could eliminate the disorder in offspring. Currently germ-line therapy is banned in Canada. Read more about gene therapy, the use of DNA vectors to alter the genetic material in humans, and the controversy surrounding this new form of treatment on pages 660 and 661 of your textbook.

Discuss

As you do the following research, remember that technologies, their methods and use, the controversy, and the societal issues that can surround them are often part of the open response essay question on your Diploma exam.

A.  Read about “Ownership of Genetic Information” on page 653 and 654 of your textbook. Think about the following questions and create a discussion posting stating your opinions. Check out some of the other postings by your classmates and respond to at least two.

Who owns the genetic information of the transgenic organisms? Should companies have the right to sell DNA information to other companies without the permission of the people who provided the samples? Should companies that use DNA in medical research be required to share the results of their work with the individuals whose genetic information was used? What are the advantages and disadvantages of companies patenting genes like “Roundup-Ready”?

Lesson Summary

This lesson has discussed the processes and controversy involved in genetic engineering. You have learned about the steps needed to for recombinant DNA, including how DNA ligase is used to join the sticky ends created at the restriction site by restriction endonucleases. You have learned about different transgenic organisms and chimeras and discussed the advantages and disadvantages of these genetically altered organisms. You have learned about the mechanisms involved in cloning and gene therapy, and you have also discussed the controversy surrounding this science. Who owns DNA was one of the final topics of discussion in this unit. Many difficult social and ethical issues were raised in this lesson, and it will be very exciting and interesting to see what the future holds for genetic engineering. In the next lesson, you will see how the entire human DNA sequence was identified and how a knowledge of DNA sequences can help trace ancestral relationships.

Glossary

bioremediation: use of living cells to perform environmental clean-up tasks, such as using bacteria to degrade PCBs into harmless compounds

chimera: a genetically engineered organism that contains DNA from unrelated species

clones: genetically identical organisms

DNA ligase: enzyme that splices together Okazaki fragments on the lagging strand or sticky ends that have been cut by a restriction endonuclease during DNA replication

gene replacement therapy: the process of changing the function of genes to treat or prevent genetic disorders

genetic engineering: manipulation of genetic material to alter genes and blend plant, animal and bacterial DNA

germ-line therapy: gene therapy used to modify the genetic information carried in egg and sperm cells

plasmid: small self-duplication loop of DNA in a prokaryotic cell that is separate from the main chromosome and contains from one to a few genes

recombinant DNA: a molecule of DNA that includes genetic material from different sources

restriction endonuclease: type of restriction enzyme that recognizes a specific, short sequence of nucleotides within, rather than at the ends of, a strand of DNA and cuts the strand at that particular point within the sequence

restriction enzyme: enzyme that cuts DNA at specific nucleotide sequences creating fragments

restriction site: specific location within a short sequence of nucleotides in a strand of DNA at which restriction endonucleases will cut

restriction fragment: small segments of DNA cut from a DNA molecule by a restriction endonucleases

somatic gene therapy: therapy that is aimed at correcting genetic disorders in somatic (body) cells

sticky end: short sequence of unpaired nucleotides remaining at each end of a restriction fragment on a single strand of DNA after an endonuclease makes a staggered cut at the restriction site

target sequence: in DNA replication, a short sequence of nucleotides within a strand of DNA recognized and cut by restriction endonucleases

transgenic organism: produced by incorporating the DNA form one organism into another to create a new genetic combination

Lesson 3.7.6

Lesson 6—You are your Genetic Code

Get Focused

Human DNA is similar to the DNA of a pig, and to a stalk of corn. How did we get to be similar? What does this mean? In this lesson we will see how DNA can be used to trace evolutionary and genetic relationships among organisms and species. The above image is the logo for the Human Genome Project; an international project whose goal is to identify the nucleotide sequence of the human genome. We will learn about this project and how the knowledge gained from it can be applied to the study of evolution and forensics.

This lesson will address the following focusing question:

• How can we use base sequences to trace relationships between organisms within a family and between different species?

This lesson should take approximately 90 minutes to complete.

Module 7: Lesson 6 Assignment

Once you have completed the lesson you can complete the online assignment.

Bio30 3.7.6 online assignment

The other questions and activities in this lesson are not marked by the teacher; however, you should still attempt all of the work offered here. They are designed to help you review important information and build key concepts that may be applied in future lessons.

3.7.6 page 2

Read

Scientists from around the world have worked together on the Human Genome Project. This was a true collaboration involving contributions from the US, the UK, Japan, France, Germany, China, Canada and other countries.

The goal of the project was to identify the 3-billion nucleotide base pairs that make up the human genome. The project took 13 years (less then the estimated 15 years, due to technology advances) and ended in 2003. The result would be a “sourcebook” for medical science and to eventually help understand and treat over 4000 genetic diseases. The image below shows the human chromosome #1 and the genes that the 246 million base pairs code for! And this is just one chromosome! How else could this be useful knowledge? Some of the potential and current beneficial applications of this project include:

• molecular medicine
• energy sources and environmental applications
• risk assessment
• bioarchaeology, anthropology, evolution, and human migration
• DNA forensics (identification)
• agriculture, livestock breeding, and bioprocessing

In this lesson we will be concentrating on the evolutionary and DNA forensics applications of the findings of Human Genome Project. If you would like further information on the other beneficial applications mentioned above, go to the website and follow the link to “Human Genome Project Information” or do a search for “human genome project” on the Internet.

Image courtesy of the U.S. Department of Energy Genome Programs (http://genomics.energy.gov)

Watch and Listen

Watch the following video about the Human Genome Project. This video explains the project’s goals, benefits, issues/concerns, and it also introduces the DNA fingerprinting, which will be discussed in the next read section. As you watch, create a list of all of the benefits and drawback/concerns associated with the Human Genome Project. Place this list in your course folder for future reference. Contact your instructor to obtain a username and password required to access the video.

Discuss

Image courtesy of the U.S. Department of Energy Genome Programs (http://genomics.energy.gov)

This image is one of the many posters used to promote the Human Genome Project. The poster describes the areas or fields that will be impacted by the knowledge gained from the Human Genome Project. Choose another of these fields, other than forensics and evolution, to research. You can use this website and follow the link to “Human Genome Project Information” or do your own search on the Internet. Find out how the Human Genome Project (HGP) will, or has, impacted the field of study you have chosen. Create a one-paragraph discussion posting to share with students in your class. Discuss benefits and any disadvantages associated with the use of the HGP information.

Read

The video in the above Watch and Listen section described the process and uses of DNA fingerprinting. Review the tool of DNA fingerprinting, gel electrophoresis, by reading pages 649 and 650 of your textbook.

Self-Check

Through the video and reading above you should now know that DNA fingerprinting has many uses. The most well known use is the identification of criminals in forensics labs. Lesser known uses for DNA fingerprinting are: the identification of harmful strains of bacteria, the diagnosis of inherited disorders, management of wildlife genetic variation, and even the identification of the exact grapes used in a wine. The uses for this technology are endless. Another use of this technology is to help identify relationships between human beings. Given that half of the nuclear DNA of a child originates from the mother, and the other half is from the father, this information and this technology can be used to identify biological parents.

Read the “Thought Lab” titled "Reading a DNA Fingerprint" on p. 651. Answer the Analysis Questions to test your knowledge of DNA fingerprinting. Check your answers with the solutions linked below.

3.7.6 page 3

Lab 1: DNA Fingerprint Analysis

Your DNA makes you ‘YOU’. No two individuals have the same DNA unless they are identical twins, triplets etc. In this simulation you will be looking at the DNA fingerprints of frogs. You will use the DNA fingerprints to identify twin frogs and investigate the relationship between DNA fingerprints and frog traits.

Open the DNA Fingerprint Analysis Gizmo.

Problem

How can identical twins and physical characteristics be identified using DNA fingerprints?

Procedure

Follow each step in the “Exploration Guide” in the DNA fingerprint analysis gizmo.

Retrieve your copy of Module 7: Lesson 6 Assignment that you saved to your computer earlier in this lesson. Complete Part 1. Save your completed assignment in your course folder. You will receive instructions later in this lesson on when to submit your assignment to your teacher.

3.7.6 page 4

Going Beyond

Real World Applications

Research some real examples of DNA fingerprint analysis being used to solve crimes or identify people.

Read

Evolutionary Relationships Between Species

To study how different birds were related in the 1960’s, biologists would have looked at their anatomical similarities and differences. For example, the DNA of chimpanzees is 98% the same as human DNA, and the genetic similarity between 2 humans is more then 99.99%. This knowledge can be used to create a phylogenetic tree that shows the evolutionary relationships between species. Today scientists can compare the DNA of ancient plants, animals and even bacteria with the DNA of modern organisms in order to look at the ancestry of modern organisms, the movement of populations through time, the evolution of particular disease causing bacteria, and the way that ecosystems respond to climate change. Read more about this on page 647 of your textbook.

Ancestry Within a Species

Up to this point we have only been discussing nuclear DNA, but there are other types of DNA used by scientists to study ancestry: mitochondrial DNA (mtDNA) and chloroplast DNA (cpDNA). Mitochondrial and Chloroplast DNA have their own DNA that is replicated, transcribed and translated independently from the DNA in the nucleus of the cell. The theory for how these organelles ended up in the cell is called the endosymbiont theory and can be read about on page 647 of your textbook

Typically, when fertilization occurs, the nuclear DNA of the zygote will be a combination of the two parents’ nuclear DNA. When the zygote forms, the cytoplasm and all of the cytoplasmic organelles are donated by the ovum (egg). This means that the mitochondrial DNA will be identical to the mtDNA of your mother. When you go back generations in your family tree you will see that many men and women contributed to your nuclear DNA makeup, but only one woman contributed to the mtDNA. Your mtDNA is a copy of your mother’s, which is copied from her mother, and so on. Mutations will still occur in mtDNA over time and this mutation rate can help scientists deduce ancestry. The more similar the mtDNA between people, the closer they are related. The more dissimilar the mtDNA, the more mutations must have occurred indicating more time on the evolutionary path must have elapsed.

Self-Check

SC 1. Why is your mitochondrial DNA identical to the mitochondrial DNA of your mother, rather than your father?

SC 2. Give two examples of ways that the study of DNA sequences can help scientists learn about genetic relationships, genetic variations, or evolution.

SC 3. What was the objective of the Human Genome Project?

Module Summary and Assessment

Module Summary

In this module you explored the following overarching question:

• Can we explain the transmission of traits at the molecular level by understanding the structure of DNA, its role in protein synthesis, and how it could mutate?

In this module, you learned about the historical events that lead up to the discovery of DNA and its structure. You learned how this amazingly simple, and yet complicated structure can code for genetic traits, make copies of itself, and direct the synthesis of protein (the major component of so many body parts, like the hormones you learned about in Unit A, and enzymes).

There are enzymes that can clip DNA apart, and enzymes that put it back together in a new way. You explored sources of variation and its application in various technologies. You looked at societal, medical, and ethical issues related to the field of genetic technology, which is rapidly developing many ways to alter genetic traits and treat genetic diseases. Furthermore, you saw that DNA has the tendency to stay the same, and yet it changes. These changes are random and can result in abnormalities. They can also provide a source of variability that is the basis for evolution. You saw that you can trace relationships among organisms of different species by comparing their genetic material.

Module Assessment

The following assignments should have been completed for this module as well as tutorial summaries submitted for each tutorial video.

Bio30 3.7.1 online assignment

Bio30 3.7.2 online assignment

Bio30 3.7.3 online assignment

Bio30 3.7.4 assignment

Bio30 3.7.5 assignment

Bio30 3.7.6 online assignment

As this is the last module in the unit, the unit quiz and exam can also be completed.

Unit 3 quiz,  Unit 3 Exam, 

Unit 3 Conclusion

You have completed three modules in Unit C. The major concepts you explored and the skills you developed in this unit are

• explaining the rules and steps involved in mitosis and meiosis that regulate the transmission of genetic information from one generation to the next
• describing the similarities and differences that exist in mitosis and meiosis that allow for growth, healing, and reproduction of organisms
• hypothesizing how the understanding of the molecular nature of genes and DNA can help explain the transmission of traits, and how mutation at the molecular level results in changed proteins
• analyzing how the knowledge of the molecular nature of genes and DNA has led to new biotechnologies and treatment of genetic disorders

In Module 5 you examined reproduction at the cellular level. Individual cells, like humans and all other multi-cellular organisms, need to ensure the next generation has all that it needs to survive. In human reproduction, you saw how this creates a cycle as one is born, grows, mates, and gives birth to the next generation. In a similar way, cells follow a life cycle of growth, preparation, and division. In this unit you learned how the cell life cycle naturally progresses and how cells copy their instructions for the next generation. You saw how cells divide to form new, complete cells, or divide to form incomplete cells. You examined these methods and studied their advantages and limitations. You saw just how important the regulation of the cell cycle is as you considered cancerous or “wild” cell growth.

In Module 6 you looked at how an organism passes on its traits to the next generation. As you considered these patterns of inheritance, you learned about the works of Gregor Mendel and Thomas Morgan, and how they contributed to our understanding of genetics today. You used predictive tools to understand and explain the movement of a disease or condition through a family pedigree.

In Module 7 you looked at the molecular basis for traits in the cell, and you gained an understanding of how cells express these traits through protein synthesis. You saw how mutation can change the intended expression of our genetically inherited traits. Genetic change can result in disease. It can also result in enhanced abilities, and can be the basis of evolution as explored in Unit D.